Loading...
HomeMy WebLinkAboutCC PACKET 01121988 Meeting Sheet IIIIII VIII VIII VIII VIII VIII IIII IIII iooeoi Box: 18 Folder: CC PACKETS 1987-1989 Document: CC PACKET 01121988 1 C = TY O F S T _ ANTHONY COL7NC= L AGENIDA .JANUARY 1 2 1 9 8 8 7 = 30 P _ M _ A. Call to Order/Pledge of Allegiance. A-fol _B. Roll Call.C. Approval of December 22 , 1987 Council Minutes. D. Licenses/Permits/Petitions. E. Presentation of Claims. — azz Verified. 1988 Municipal Amicus Program Dues - $123 . 00 . League of Minnesota Cities Dues - $3 ,691 . 00 . Metropolitan Waste Control Commission - $24 , 896 . 08 (November, 1987 ) . �. School District #282 - $9 , 000 . 00 . Fullerton Lumber Co. - $34 , 599 . 00 . 72Z,c ,, Commander John Hearn will be present regarding a Tri-City American Legion presentation to the City. - 3 F. Reports. U _ 1 . Council- 2 . Departments and Committees. Hance & LeVahn Ltd. , re: matters conducted at the Hennepin County District Court on December 16 , 1987. V45r' Liquor Operations Sales Summary - December , 1987 . Via® Financial Report - November, 1987 . Fire Department Report - December, 1987 . tz City Manager. Staff Meeting Notes - January 5 , 1988 . -2- G. Pub is Hearings. \ 8 : 00 P.M. - St. Anthony Boulevard improvements on the south end; approval of Resolution 88-007 , re : ordering improvement and preparation of plans . H. New Business . 1 . Appointments to Planning Commission. 2 . Purchase of a Hand Paint Striper. 3 . Purchase of a 3/4 Ton Pick Up Truck. 4 . Supplemental Engineering Services Agreement with the City of Columbia Heights . 5 . Approval of Auditing Services for Year Ending December 31 , 1987 . 6 . Resolution 88-001 , re: designating Mayor Pro Tem. 7 , Resolution 88-002 , re: signatures on drafts drawn against City deposits . 8 . Resolution 88-003 , re: designating legal newspaper. 9 . Resolution 88-004 , re: cut-off date for petitions for City improvements . 10 . Resolution 88-005 , re: designate depository for City funds. 11 . Resolution 88-006 , re: funding for Northern Mayors ' Association. 12 . Ordinance 1988-001 , re: amending weapons section ( 1st reading) . 13 . Ordinance 1988-002 , re: amending controlled substances section ( 1st reading) . I . Unfinished Business. J. Adjournment. in a illa te hon Administrative Offices 3301 Silver Lake Road, St. Anthony, Minnesota 55418 (612) 789-8881 OFFICIAL OATH STATE OF MINNESOTA ) COUNTIES OF HENNEPIN/RAMSEY) I , do solemnly swear that will support the Constitution of the United States, the Constitution of the State of Minnesota, and I will faithfully, justly, and impartially discharge the duties of the position of Mayor of the City of St. Anthony, Minnesota, to the best of my judgement and ability. So help me God. Subscribed and sworn to before me this day of 19 City Clerk Robert(Bob)Sundland,Mayor David Childs,City Manager Councilmembers Richard A. Enrooth,Judy Makowske,George Marks,Clarence Ranallo 1 O C = TY OF ST' . ANTHONfY COiJNC I L AGENDA .J AN U ARY 1- 2 1 9 8 8 7 e 30 PeMo I A. Call to Order/Pledge of Allegiance. - - --B. - Roll- Call. - C . Approval of December 22 , 1987 Council Minutes. D. Licenses/Permits/Petitions.. . - E. Presentation of Claims . 1 . Verified. 2 . 3. " 88 Municipal Amicus Program Dues -. $123 . 00 . 3 . Lague of Minnesota Cities Dues - $3 ,691 . 00 . 4 . [ .:tropolitan Waste Controi .Commission - $24.,.896 . 0.8 1ovember , 1987 ) .. 5 . �hooi District #282 - $9 , 000 . 00 . 6 . jullerton Lumber Co. - $34 , 599 . 00. Commar. 'er John Hearn will be pr.esent regardinq a Tri-City Americ 2 Legion presentation to. the -City''. F. - Reports 1 . Col lcil. 2 . Departments and. Committees.. a. Hance & Levahn Ltd. , re: matters conducted . at the Hennepin County District Court on -December 16.,. 1987 . b. Liquor Operations Sales Summary - December, 1987 . C. Financial Report - November, 198.7 . , d. Fire. Department Report -. December,, 1987 . 3 . City Manager . a . Staff Meeting Notes - January 5 , 1988 . -2- r. • G. Public Hearings . 1 . 8 : 00 P.M. - St.- Anthony Boulevard improvements on the south end; approval of Resolution 88-007 , re: ordering improvement and preparation of plans . H. New Business . 1 . Appointments to Planning Commission. 2 . Purchase of a Hand Paint Striper. 3 . Purchase of a 3/4 Ton Pick Up Truck. 4 . Supplemental Engineering Services Agreement with the City of Columbia Heights . 5 . Approval of Auditing Services for Year Ending December 31 , 1987 . 6 . Resolution 88-001 , re: designating Mayor Pro Tem. 7 . Resolution 88-002 , re: signatures on drafts drawn against City deposits . 8 . Resolution 88-003 , re: designating legal newspaper. 9 . Resolution 88-004 , re : cut-off date for petitions for City improvements . 10 . Resolution 88-005 , re: designate depository -''or City. funds. 11 . Resolution 88-006 , re: funding for Northern f:ayors ' Association. 12 . Ordinance 1988-001 , re: amending weapons section ( 1st reading) . 13 . Ordinance 1988-002 , re: amending controlled F�-.ubstances section ( 1st reading) . I . Unfinished Business . J. Adjournment. t V' C=r12 7Z O F S T _ ANTHONY • C OUN C = L M=NUT E S D E C EMB E R 2 2 2 9 8 7 1 The meeting was opened at 5 : 00 P.M. with the Pledge of Allegiance led 2 by Mayor Sundland. 3 Present for roll call: Marks, Ranallo, Sundland, Makowske (arrived 4 at 5 : 01 P.M. ) Enrooth ( arrived at 5 : 13 P.M. ) . 5 DECEMBER 8 , 1987 COUNCIL MINUTES 6 Motion by Marks, seconded by Ranallo to approve as submitted. 7 Motion carried unanimously. 8 Councilmember Makowske arrived after the above vote had been taken and 9 later in the meeting suggested the following changes in the minutes to 10 reflect the fact that the Mayor had never actually voted one way or 11 another on the pull tabs issue and also felt "the rest of you voted as 12 you thought the_communi-ty wou-ld—wan-t—you—to vote-. " 13 Page 18 , line 26 : Strike "three" and make "other" plural. 014 Mayor Sundland indicated he perceived his comments in lines 35 through 15 37 had clearly indicated his intent in the matter. 16 LICENSES/PERMITS/PETITIONS 17 Motion by Ranallo, seconded by Makowske to grant heating licenses to 18 the following as listed in the December 22nd Council agenda packet: 19 Preferred Mechanical Services, Inc. , Minneapolis 20 Midland Heating and Air Conditioning, Richfield 21 Bowler Company, Minneapolis 22 Motion carried unanimously. 23 CLAIMS 24 TABLED FULLERTON BILL PAID 25 Before a vote on the claims listed in the agenda packet was taken, Mr. 26 Childs reported on the construction progress on the Stonehouse liquor 27 warehouse addition for which payment to the Fullerton Lumber Company 28 had been tabled December 8th. He reported that: • 1 P �e 1 *the external wail as well as heating, cooling and ventilation 2 systems are all installed; 3 *the frame for the rear doors is in but the new doors have not 4 been installed because some of the interior fixtures have to be 5 brought in first ; 6 *the ceilings and bar joists have all been painted but the sheet- 7 rock walls have to be taped and painted after the lighting 8 fixtures have been installed; 9 10 *the floor tile will then be laid; 11 *most of the work remaining to be done is waiting for the new 12 door which has been ordered and is included on the December 6th 13 Change Order to be considered later in the agenda. 14 In relation to whether or not the City'snegotiatinq position would be 15 improved by withholding payment on the contract, Mr. Childs indicated 16 the payment due that evening only covered work the contractor had 17 completed by December 4th and the work remaining to be done would be 18 much less than the $67 , 567 still due on the contract. He indicated he 19 perceived that fact made the possibility of the contractor walking 20 away from the job very remote and the City Manager pointed out that 21 the bond would provide further protection from that ever happening. 22 Mr . Childs reiterated that , althouqh the City' s expectations had been • 23 raised by the contractor ' s promise to get the work completed in 24 October , as a practical matter , Fullerton had only been legally 25 required to be done by December 1st , which would have been too late 26 for the City to make the transfer and to open before the holiday sales :?7 period. ' Councilmember Ranailo agreed that , since the warehouse was 28 not operating in 'the new space by December 1st, there was little 29 chance of the City collecting loss of business damages before January 30 1st because it would have taken at least 30 days for the City to get, 31 the store operational. However, he said he now perceived the City 32 should have every right to make the contractors pay the rent which 33 would be due from January 1st on at the present location. The 34 general consensus was that the Council would deny any further exten- 35 sions of the contract when the Change Order was brought up •again later 36 in the agenda. 37 Council Action 38 Motion by Marks , seconded by Ranallo to approve payment of the 39 following claims as listed in the December 22nd Council agenda packet: 40 *all November 30th City accounts payable and November 30th and 41 December 15th Liquor accounts payable; 42 *$61, 078 . 00 to the Fullerton Lumber Company for construction 43 services on the Stonehouse liquor warehouse addition; • 2 ti *$3 , 060 . 00 to Decision Resources Ltd. as the first payment due 2 prior to the residential survey and written analysis of 400 3 randomly selected households related to quality of life issues 4 in St . Anthony; 5 *$3 , 319 . 11 to Briggs and Morgan for legal services connected to 6 the City' s lawsuit against the U. S. Army et al relative to 7 St. Anthony' s water contamination problems. 8 Motion carried unanimously. 9 REPORTS 10 COUNCIL 11 Makowske Reports on Resolutions Passed During RCLLG December 16th 12 Meeting 13 The Councilmember reported she had voted on only 2 of the 3 issues 14 which had passed that evening because she had some real concerns about 15 re-establishing a Ramsey County Park Board which might turn out to be 16 similar to the Minneapolis Park Board. 17 Seasons Greetings Extended 08 Mayor Sundland extended his wife, Ardelle ' s, and his own best wishes 19 for a Merry Christmas and a Happy New Year to the other Councilmem- 20 bers and staff . 21 Marks to Serve on Jury in January 22 When Councilmember Marks indicated he had been notified to report for 23 the above duty on January 11th, Councilmember Ranallo told him not to 24 expect to be called for many cases because of his City official 25 background, especially his responsibilities as employer of the police 26 force. 27 Councilmember Enrooth arrived at 5 : 13 P.M. 28 DEPARTMENTS/COMMITTEES/COMMISSIONS 29 *the number of bench warrants were again noted before the Hance & 30 LeVahn report on the criminal cases in which the prosecutors had 31 represented the City at Hennepin County District Court on December 32 2nd was ordered filed. 33 *Councilmember Marks indicated he missed having a report on the number 34 of calls which had previously been included in the cover summary 35 sheet on Fire Department reports . However, he appreciated the 36 listing in the November report which told him just how much time •7 had been spent for different types of calls , which showed only one 3 U , 1 hour and. forty-five minutes devoted to- actual firefighting activities 2 while almost. 15 hours were spent responding to .medicals . Before 3 the report was ordered filed, Mr. Childs said he would bring their 4 preferences to the attention of the Fire Chief. 5 *the November Police Department report was also ordered filed follow- 6 ing a brief discussion of Councilmember Makowske ' s Christmas tree 7 being stolen and recovered. i 8 CITY MANAGER 9 December 15 , 1987 Staff Meeting Notes 10 *Mr. Childs reported Officer Bill Ferguson. was in the hospital 11 with back problems which were not job related but nevertheless 12 would require a fill-in until he is able to return to duty. 13 14 *Fridley KC ' s to Sponsor Police Appreciation Dinner 15 Councilmember Ranallo, who heads this organization, indicated 16 final approval had, been given the- event. 17 Marks Designated as St.. Anthony' s AMM Legislative Contact Person 18 A copy of the December 16th letter from Vern Peterson of the Associa- 19 tion of Metropolitan Municipalities seeking the above person to 20 represent St. Anthony had been included in the agenda packet and the • 21 Councilmember indicated he would be interested in serving. 22 Council Action 23 Motion by Makowske, seconded by Enrooth to designate Councilmember 24 Marks for the: position. 25 Motion carried unanimously. 26 Change Order for Stonehouse Liquor Warehouse Project Approved Without 27 35 Day Extension 28 Before discussing the $2 , 460 . 00 change order to be considered that 29 evening, Mr. Childs pointed out that with the $2 ,756 . 00 in extras 30 approved in two previous change orders on the project, extras only 31 amounted to to of the project cost, which, even with the delays, was 32 minimal considering that average change orders on all projects run 33 around 50 . 34 In reference to the three items before the Council that evening, the 35 City Manager explained: 36 *$650 . 00 for a wider fire door between the new and old off sale 37 facilities had been City requested; 4 r *the architect had agreed to reimburse the City for between $500 2 to $600 of the $970 . 00 it cost to add an exterior finish system 3 to the higher west parapet wall because it had been BWBR' s fail- 4 ure to let the contractor know the change was required before 5 his crews left which had resulted in a higher cost for that 6 project; 7 *the City had not been able to use all the old entrance door 8 control mats for the new front door and had to pay $849 . 00 9 for three new ones , which should be enough for now at least, 10 although a few of the others may need replacement later. 11 Recalling the conversations earlier in the evening, Mr. Childs 12 recommended the Council deny the requested 35 day extension on the 13 job and instead, instruct him to see what he could negotiate in the 14 way of a trade-off in rent for the time the City has to remain in the 15 old location as a result of the contractor ' s failure to get the 16 project completed at least by January 1st. The City Manager 17 indicated he believed the major part of the contract increase could be 18 directly attributed to Fullerton' s failure and no one else ' s. 19 Councilmember Enrooth agreed that the contractor should be asked to 20 pay the rent on the old location past January 1st because he perceived 21 time was of the essence now to get the liquor operation moved during 22 what has always been the slowest seasonal sales period after the 46 3 holidays . 24 Council Action 25 motion by Ranallo, seconded by Marks to approve the $2 , 469 . 00 Change 26 order on the Stonehouse liquor warehouse project, less the amount of 27 the error on the exterior wall finish system to be paid by the 28 architect but to deny the requested 35 day extension on the contract. 29 Motion carried unanimously. 30 Bids Lower Than Engineer Estimated on Kenzie Traffic Signal 31 As stated in the December 16th letter from the project engineer, Rieke 32 Carroll Muller Associates , Inc. , the low bid of four made on this 33 project came from Collins Electric for $67 , 567 . 00 , about $3 , 000 less 34 than the $70 , 000/$80 , 000 the engineers had estimated the job would 35 cost. 36 Mr . Childs indicated this would bring the total project cost up to 37 around $75 ,000 when engineering costs are included. He also indicated 38 he had consulted Mr. Soth regarding the contractor ' s typo error 39 indicating the bid security as $350 rather than $3 , 500 as provided in 40 the bid bond and the City attorney had advised that the 5% bid bond 41 would prevail. • 5 r� 1 Councilmember Ranallo emphasized Collins Electric would be paying • 2 prevailing wages on the job, since, as the City Manager had indicated, 3 they had been written into the contract. 4 Mayor Sundland said he knew Collins had a lot of street light 5 experience and pointed to the engineer ' s- assessment of them "as a 6 reputable contractor doing acceptable work." 7 Council Action 8 Motion by Marks , seconded by Sundland to award the contract- for the 9 Kenzie Terrace traffic signals to the low- bidder , Collins Electric 10 for $67 , 567 . 00 . 11 Motion carried unanimously. 12 ADJOURNMENT 13 Motion by Marks, seconded by Enrooth to adjourn the meeting at 5 : 28 14 P.M. 15 Motion carried unanimously. 16 Respectfully submitted , 17 Helen Crowe , Secretary • 18 19 Mayor 20 ATTEST: 21 City Clerk 22 :cjk 23 • 6 ail 110" .�..o..r...��4 A:P P R 0'V A L e r January 6, 1988 i _ M jor and Councilmembers Lila Johnson, License/Billing Clerk r-E1-1 " LICENSES FOR COUNCIL APPROVAL MOTOR VEHICLE STARTING Sroga's Automotive CONTRACTORS ' iBrandon Construction, Champlin G a :Cjkl.12.88 C .I T Y O F S T . A N T H O N Y P/E 12/31/87 A C C O U N T S P A Y A B L E PAGE 1 VENDOR NAME CHECK CHECK CHECK • NO. TYPE DATE NO. AMOUNT 00020 AA BATTERY CO R 12/31 /87 13917 98.11 00045 ACRD-MINNESOTA R 12/ 31/87 .13918 12.61 00104 ALMAC PLASTICS INC R 12/ 31/87 13919 77.28 00120 AMERICAN LINEN R 12/31/87 13920 24.80 00200 EARL ANDERSON ASSOC R 12/31/87 1.3921 54.78 00250 AUTOMATIC GARAGE OOOR ' CO R 12/31187 13922 208.31 00280 BARTON CONTRACTING R 12/31/87 13923 169.52 00310 BATTERY S TIRE WHSE R 12/31/87 13924 14.64 00320 BEISSWENGER APPLIANCE R 12/31187 13925 299.95 00610 CATCO CLUTCH S TRANS SVC R 12/31/ 37 13926 101.70 00625 COPY DUPL PRODUCTS INC R 12/31/87 13927 207.96 00810 DICKSON ELECTRIC R 12/ 31/87 13928 3050.00 00830 ZEE MEDICAL SERVICE R 12/31/87 1392.9 23.35 00950 FIRESTONE TIRE CO R 12/31 /87 13930 1 ,016.82 01030 G C K SERVICES R 12/31/87 .13931 226.30 01140 GENUINE PARTS CO R 12/31/87 13932 26.97 01145 GLENWOOD INGLEWOOD R 12/3.1 /87 13933 34.35 01180 GOODIN COMPANY R 12/31/87 13934 3.31 01250 GRAINGER INC , W W R 12/31/87 13935 162.46 01285 GRIFFIS OXYGEN R 12/31 /87 13936 286.85 01360 HALLING BROS R .12/31/87 13937 4.69 01412 JIM HATCH SALES R 12/31/87 13938 19363.60 • 01500 HENNEPIN CTY FINANCE DIV R 12/31/87 13939 6.02 01505 HENN CO SHERIFF R 12/31/87 13940 29127.42 01580 HYDRAULIC SPECIALITY CO R 12/31/87 13941 335.00 01601 INGMAN LAB R 12/31/87 13942 68.00 01680 J C AUTO SUPPLY R 12/31/87 13943 121.53 01900 LAKELAND ENG + EQUIPMT CO R 12/ 31/87 13944 221.28 02040 LILLIE SUBURBAN NEWSPAPER R 12/31/87 13945 38.86 02060 MB .INDUSTRIAL SUPPLY CO R 12/31/87 13946 9.03- 02130 MAMA R 12/31/87 13947 24.00 02220 MELS VAN 0 LITE R 12/31/87 13948 391 .62 02280 MIDWEST ASPHALT CORP R 12/31/87 13949 790.05 02740 OLSON RADIATOR, DAVE R 12/31/87 13950 150.00 02780 PAPER CALMENSON CO R 12/31/87 13951 8.79 02940 POSTMASTER R 12/31 /87 13952 300.00 02980 PROFESSIONAL PROCESSING ,C R .12/31/87 13953 531.51` 03060 ROAD MACHINERY S SUPPLIES R 12/31/87 13954 19.74 03080 ROLLINS OIL CO R 12/31/87 13955 39666.10 03100 ROSEDALE CHEVROLET R 12/31/87 13956 46.85 03275 SCHUTTA• S HOWE INC R 12/31/87 13957 120.22 03315 SERC O LABORATORIES R 12/31 /87 13958 197.00 03355 SILVER LAKE CLINIC R 12/31/87 13959 91000 03485 ST TREAS SURP PROP FUND R 12/31/87 13960 41.00 03640 TWIN CITY ENGINE • REBLDRS R 12/31/87 13961 41.66 03660 RAMSEY COUNTY R 12/31/87 13962 115.21 03670 UNIFORMS UNLIMITED R 12/31/87 13963 223.75 03720 W W GENERATOR REBUILDERS R 12/31/87 13964 83.95 • 03735 WASTE MGMT R 12/31/87 13965 172.50 03740 WATER PRODUCTS CO R 12/31/87 13966 49017.76 C I T Y O F S T A N T H O N Y PIE 12/31/87 A C C O U N T S P A Y A B L E PAGE 2 VENDOR NAME CHECK CHECK CH6 N0. TYPE DATE NO. AM �T 03820 ZAHL EQUIPMENT CO R 12/31 /87 13967 239.40 03840 ZEP MFG CO R 12/31/87 13968 263.75 059025 WILLIAMS ELECTRIC INC R 12131/87 13969 26. 63 05026 CENTURY SALES COMPANY INC R 12/31/87 13970 9.30 05027 C R C R 12/31/87 13971 449.00 05028 AMERICAN SEMI-PARTS INC R 12/31/87 13972 25.45 05029 CLEVELAND COTTON PRODUCTS R 12/31/87 13973 115.39 05030 DIXIE USA INC R 1.2/3.1/87 .13974 119.90 05031 E M P R 12/31/87 13975 19. 07 05032 FADDEN PUMP CO R 12/31 /87 .13976 222.48 05033 LOWELL 'S R 12/31/87 13977 50.79 05034 JEMS R 12/31/87 13978 29.95 06718 ZACK' S CLEANING SUPPLIES R 12/31/87 13979 75.00 06719 ZEE MEDICAL SERVICE R 12/31/ 87 13980 44.35 06764 BILL .CLARK OIL R 12/31/87 13981 477.30 06783 HEALTH FITNESS CONSULTANT R 12/31 /87 13982 310.00 06965 DAVE WILSON R 12/31/87 13983 585.60 06991 MONROE SYSTEMS IN R 12/31/£7 13984 149.00 06992 GORDON B MILLER R 12/31/87 13985 555.15 06993 LYNN PEAVEY COMPANY R 12/31/87 13986 208.64 06994 ACE HARDWARE R 12/31/87 13 987 7.87 06995 L-Z COMPANY R. 12/31/87 13988 27. 17 06996 NARDINI R 12/3.1/87 13989 2.3 0 06997 ROAD RESCUE - INC R 12/31/87 13990 11. 3 06998 STEWARTS LUMBER CO R 12/31/87 13991 5.07 06999 VIKING ELECTRIC SUPPLY R 12/31 /87 13992 38.42 TYPE TOTAL 259726.52 TOTAL 259726.52 I \ 1`/21/87 1988 MAP (MUNICIPAL AMICUS PROGRAM) DUES City of: St. Anthony Special membership in MAP Jar.. 1, 1988 - Aug. 31, 1988: $123 • Your LMC Dues are: $3691 Because, your City Attorney is a CLEAR member, you pay only 3. 33 percent of these dues. Please submit payment to: League of Minnesota Cities MAP Program Thank you. • is r 1 183 University Ave.East St.Paul,MN 55101-2526 League of Minnesota Cities (612)227-5600(FAX:221.0986) December 18 , 1987 To: Communities who belong to the Municipal Amicus Program (MAP) From: Tom Grundhoefer MAP Staff Attorney Thank you for your interest in the League's Municipal Amicus . Program and for your support. Enclosed is an invoice for your 1988 MAP membership. Also enclosed is a 1987 MAP Update. .Please note the invoice covers the period from January 1 through August 31 rather than the full calendar year. To avoid accounting confusion and to avoid billing League and MAP dues to cities at two different times each year, the MAP dues -and budget year is being changed from the current calendar year to the League's fiscal year September 1 - August 31. Instead of paying ten percent of your League dues (or five percent if your city attorney is a CLEAR member)• your invoice is for eight months or two-thirds of that amount. As you can see on the Update, your support of the Municipal Amicus Program has enabled MAP to file 14 amicus briefs on a wide variety of subjects since MAP's formation in March of 1986. Prior to that, the League averaged only two or three amicus briefs a year. MAP has become an essential element in the League's effort to influence the .development of law affecting Minnesota cities. We will appreciate your continued support of this very worthwhile program. • 1987 MAP UPDATE 1987 has been an active year for the League's Municipal Amicus Program (MAP) . The program has allowed the League to have greater impact on the increasing volume of appellate court cases affecting Minnesota municipalities. Since June of 1986 the program has filed 14 amicus briefs. One additional brief is pending. of the cases with final dispositions, the League has had 4 successes and 2 losses. There are currently 7 cases waiting final disposition. The program has filed briefs or memoranda in the following cases: * Lund v. Hennepin County: a case challenging the constitutionality of the state's property tax system. Disposition: Case was decided in the County's favor by the Minnesota Supreme Court. The United Stated Supreme Court dismissed an appeal . * Anderson v. City of Hopkins: a case challenging the right of a city .and its employees to immediately appeal to the Court of Appeals, from a trial court's wrongful denial of a summary judgment motion on the issue of qual"ified immunity. Disposition: Case was decided in City's favor .establishing an immediate right to appeal . The case allows cities to potentially avoid burdensome litigation in otherwise frivolous lawsuits. * Wesala v. City of Virginia: -a case challenging the Court of Appeals decision holding that a city waives its various statutory immunities by belonging to the League of Minnesota Cities Insurance Trust (LMCIT) . Disposition: After accepting the case for review, the Minnesota Supreme Court reversed itself and decided not to hear the appeal. * Swanson v. City of Bloomington: a case involving the scope of judicial review of municipal zoning decisions. Disposition: Case is pending before the Minnesota Supreme Court. * City of Eden Praire v. Leipke: a case involving the extent to which a city may be estopped from enforcing its zoning ordinance because of alleged actions of the city's zoning and building officials. Disposition: Court of Appeals -ruled against the City and returned the matter to the trial court for further testimony. * Chabot v. City of Sauk Rapids: a case reviewing the issue of the whether a city waives its discretionary immunity by procuring • liability insurance. Disposition: The Court of Appeals found against the City. The Minnesota Supreme Court has accepted review and granted the League's request to file an amicus brief. o, * Anderson v. City of Willmar et al: a case addressing the issue of whether a police civil service commission may lawfully use independent examiners to conduct examinations and make recommendations concerning prospective job applicants. Disposition: The Court of Appeals found use of independent examiners was an unlawful delegation of authority. The Minnesota Supreme Court reversed the Court of Appeals finding that the delegation was lawful. * Shortridge v. City of Maplewood et al: a special assessment matter raising the issue of whether a property owner may challenge a special assessment 3 years after it has been imposed, on the ground that the notice of hearing contained a defect. Disposition: The Court of Appeals found against the City. The Minnesota Supreme Court accepted further review and -the case is currently pending before it. * Independent School District #254 v. City of Kenyon: a special assessment case challenging the .City's method of apportioning assessments for storm trunk sewer projects. Disposition: The Court of Appeals found against the City. * Bahr v. City of Litchfield: a case challenging a civil service promotion decision. Plaintiffs claimed defects in .the process; but waited approximately 18 months before bringing their lawsuit. Disposition: The Court of Appeals found against the City. The matter is pending before the Minnesota Supreme Court. * Minnesota Teamsters v. Washington County: a case addressing the issue of whether health insurance for retirees is a mandatory subject of bargaining under the Minnesota Public Employees Labor Relations Act (MPELRA) . Disposition: , The Court of Appeals found in favor of the County. The Teamsters have petitioned the Minnesota Supreme Court for further review. * State v. Holmquist: a case involving the doctrine of discretionary immunity and whether the doctrine applies in instances of alleged defects in the design of a road. Disposition: The Court of Appeals found against the State. The matter is pending before the Minnesota Supreme Court. * Crystal Green v. City of Crystal: a case involving a challenge to a plat dedication requirement. The challenge was brought after the plat had been approved and recorded. The City argued that the challenge was brought too late. Disposition: The case is pending before the Court of Appeals. • * Snyder v. City of Minneapolis: A case raising the issue of the constitutionality- of the Municipal Tort Liability Limits. Disposition: The case is pending before the Court of Appeals. WA/TE POLffAfl METROPOLITA�11 WASTE COt1TROL CONTROL COMMISSION' (omm1lIIO(1 Twin Cities Rrea 350 METRO SQUARE BUILDING ST. PAUL, MN 55101 PHONE (612) 222-8423 CITY OF ST ANTHONY ACCOUNTS PAYABLE 3301 SILVER LAKE ROAD ST ANTHONY MN 55418 INVOICE 10/01/87 0022475-000 OVEMBER 0004797 INUOICE.OATE,;. CUSTOMER ACCOUNT:NUMBER. $ERVlCE. MONTH aNVOICE`NO AMOUNT: 401 SEWER SERVICE CHARGES 24,896.08 • TOTAL: 24,896.08 Due on -the first>day :of the service:month :installments:not received ;by the`70th day,of each month:An which::due shall be :tegarded as;Aelinquent and shall:bear inter.est':from the 1rst sday of:ouch=month :01:the rate of ;18°10;:per :anum. As`per slaws>of~Minnesota'.798.5, chapter 136: I N V O I C E • ST. ANTHONY IND. SCHOOL DIST. 282 -3303 33rd Avenue N. E. Minneapolis, Minnesota 55418 Date November .1, 1987 To City of St. Anthony Address 3301 Silver Luke Road City Minneapolis State MN 55418 Organization Use of Park View Facilities Date October, November, December 9.000.00 Rental Charges Cook Charges hrs @ hrs @ Janitor Charges hrs @ hrs @ Other Charges Total 9,000.0 _ J I APF OATION AND CERTIFICATE FOR PAYI\ *r AIA DOCUMENT G702 PAGt OF PAG(S PROJECT: St. Anthony Liquor Addition ARCi-ii uCT: B W B R Architects (n a m c, address) ARCHITECT'S PROJECT NO: TO (Owner) City or St. Anthony CONTRACTOR: Fullerton Wilber Co. CONTRACT FOR: APPLICATION DATE: ) c�1�0�� APPLICATION NO: Al TN: PERIOD FROM: J�� I�f `> TO CHANGE ORDER SUMMARY Application is made for Payment, as shown below, in connection with the Contract. Conlinualion Sheel,AIA Document G702A, is attached. Change Orders approved ADDITIONS S DEDUCTIONS $ in previous months by The present slaltJs of the account for this Contract is as follows: Owner— TOTAL SuhsrquentChangeOrders ORIGINAL CONTRACT SUM . . . . .. . . . . . . . . . . . . . . . .$ 288,5UO.00 PJUrnhrr A (dale)e) Net change by Change Orders .$ f'� i o , 8-) a OL, 3°" CONTRACT SUM TO DATE.: TOTAL COMPLETED & STORED TO DATE . . . ..; . .. .$-L1 (Column G on G702A) E.3�Sj_7__1 , TOTALS _ RCTAINAGC �4";.. . . . . . . . . . . . . . . . . . Nel change by Change Ordcfs $ 1,, f or as noted in C-910i'r1n t on G702A .2 .S 1 9Sd TOTAL EAR wP TAINAGE . . . . . . . . . . . . . .. .. Stale of: County of: `( S The undersigned Contractor certifies that the Work covered by this Appli- L 'B+��I G Vb�aFIG�'LES�FOR PAYMENT . . . . . . . .$� cation for Payment has been completed in accordance with the Contract - P, Qv e Documents, that all amounts have been bald by him for work for which previous Cerlihcales for Payment were issue.d and payments received from ;w:::; ui� pPt t .,VAQ'�*{fJT'DUE $ uhe Owner, and that the current payment shown herein is now clue. ifscrjlstiifancl sw rn Io before me Iluisda of 19 Cnnlrac r: ter- y b •'Notary Public: , ter• B)': Dale: My Commission expires. a In accordance will tl e Contract and this Application for Payment life Contractor is entitled to payment in the amount shown above. ❑ OWNER Architect: (14 le--P, ❑ ARCHITECT • f' `` SG.,a►- (4+(13 8 -1.°- ❑ CONTRACTOR ny: )v ❑ This Cerlificalr. is no nr;oliahle. I is payal a only to the payee named hr.rein and its issuance, payment and acceptance arc wilh(1ul wejudice lo any rights of the Owner or Contractor under their Contract. AIA f)Or:UMI.NT 6102 AI'1'll(:ATI AND (IRIIFICAlr. 101( I'AYMI:NT • MARCH 1971 I:DICION • AIA(1) 1'171 • IIII Ah1fRIC:AN INSII11,11F 01" AP01117I.CIS, 17)5 NIAV Y()I(K AVI:., N.1'V„WASIIIN(:I(1N,I). C.211006 1 I CONTINUATION SHEET i1lA DOCUMENT 6703 PAGE or I'AGES AIA Document G702, APPLICATION AND CERTIFICATE FOR PAYMENT, containing APPLICATION NUMBER: S Contractor's signed Certification is attached. APPLICATION DATE: 1 In tabulations below,amounts are stated to the nearest dollar. PERIOD FROM: I a J t-1 I8 Use Column I on Contracts where variable retainage for line items may apPly. TO: I al 3olg ARCHITECT'S PROJECT NO: A 13 C D L r WORK COMI'LL1'EU FOTAL COMPLETED VALANCE RE'rAINAGE ITEM DESCRIPTION OF WORK SCHEDULED This Application AND STORED �� TO FINISH No. VALUE I'rcvivus 1'0 DATE (G=C) (C_G) Stored Materials (D•I-E-FF) Applications Work in Place (riot in D or E) General Conditions 10,500 u, -) 'c I +�".�_ Exc. F, Demo, Related 24,000 �� '-'I)v<;:rJ '"I,wU )oU _ Concrete, Masonry F, C>Q I c� 34,300 3 '',�:, C::,C:_J r.� 0U Related Structural Steel 20,900 moo U Steel l;rcction 5,400 S ,`i o r) 5. LI o0 I C-)Q ) O j\lisc. Material E, Labor 4 ,800 I xt . Wall Finish, 18,200 I —), .=>- _Irk, ) ?,7.� ,_� I<:N. Roof ng.-1 1�clatcd 14 ,900 t �t �:, � ,6`,r cn I —1 ,.�n0 ► �'t: , �' I-N Doors �; Hardware 3,100 6 � 1 CDCD Alun Entrance F, boors 7,700 Automatic Doors FI LI I_1 00 8 If Related S,400 Sheetrock F, Steel Studs - F, Itellted 1:1.,200 4 4 0 0 W CC is C'U I , �I Cv'�_:% I c o, C c�v Trans . Panel S�stout — , •.. ., _-. Resilient Floor 3,700 1 C� CJ I LJC_) H L7 Painting 4,300 , Fire Extinguishers 200 13 Dock ficluipment 250 a5 CO Solarium 8,100 ti O S I�lechanical E, Related 38,500 a OU!� j, , �U Electrical F, Related 34,500 a 1-9,Soo LI , C) c:1v 3 U, A ti c� Qc:� ► S �� Supervision - 34,150 � ,.�,C�C� ::,) E(: A' .. LAW OFFICES HANCE G LEVAHN , LTD. • SAINT ANTHONY NATIONAL BANK BUILDING, SUITE 200 2401 LOWRY AVENUE NORTHEAST MINNEAPOLIS, MINNESOTA 55418 EDWARD J. HANCE JOEL T. LEVAHN PAUL W. FANNING TELEPHONE ALLEN R. DESMOND 612 761-4858 ASSISTANTS TERESA H. CRAVEN KATHRYN A. DAILEY ' December 21, 1987 / Mr. David Childs City Manager City of St. Anthony 3301 Silver Lake Road St. Anthony, Minnesota 55418 Captain Richard Engstrom St. Anthony Police Department 3301 Silver Lake Road St. Anthony, Minnesota 55418 Chief Donald Hickerson St. Anthony Police Department 3301 Silver Lake Road St. Anthony, Minnesota 55418 Gentlemen: Enclosed herewith please find a copy of a report indicating various matters conducted at the Hennepin County District Court on December 16 , 1987. :--7 Should you have-'any questions or comments, please contact me. Yours vve.r- tru1 , ,EDWARD�-Z. HANCE Enclosure EJH/kd ST. ANTHONY PROSECUTION ACTIVITY December 16 , 1987 EDWARD J. HANCE LAW OFFICES , LTD. Submitted by: Edward J. Hance Prosecuting Attorney 2401 Lowry Avenue N.E. , Suite 200 Minneapolis, Minnesota 55418 Telephone: (612) 781-6539 A R R A I G N M E N T S - The Honorable Herbert E. Wolner DEFENDANT PLEA SENTENCE Balfany, Joel Dennis Charged with DWI , alcohol Fine - $700.00 , $600 .00 stayed one 108 concentration of . 10 or more year; Jail - 90 days, 90 days stayed within two hours ( .14) , and one year; On conditions of no open bottle; -Pled guilty to alcohol- or drug-related traffic alcohol concentration of .10 or offenses and no insurance violations more within two hours; Other for one year , completion of 20 hours charges dismissed. of community service in lieu of fine within six months, and attendance at DWI clinic within 90 days. Botzet, Kenneth Richard Charged with DWI and speeding; 108 Pre-Trial set for January 6 , 1988. Brennan, *Joseph Richard Charged with no insurance, Fine - $225.00; Jail - 15 days, 15 115 illegal use of another vehicle' s days stayed one year; On condition license tabs, expired registra- of no same or similar offenses for tion, and possession of marijuana one year. in a motor vehicle; Pled guilty to no insurance charge; Other charges dismissed. Carda, Jon Harold Charged with DWI, alcohol Fine - $700.00 , $450.00 stayed one 113, 115 concentration of .10 or more year; Jail - 90 days, 88 days stayed within two hours ( .20) , alcohol one. year; On conditions of no concentration of .10 or more alcohol-related driving offenses and (.20) , careless driving, and no driver's license or insurance no insurance; Pled guilty to violations for one year and comple- DWI; Other charges dismissed. tion of Operation Foresight. Charter , Daniel James Charged with DAS , no insurance, Fine - $200.00 ; Jail - 5 days, 5 116 and expired plates; Pled guilty days stayed one year; On condition to no insurance charge; Other of no same or similar offenses for charges dismissed. one year. Drobnick, Karl James Charged with incorrect address 108 on driver's license; Charge dismissed as Defendant proved to the court that he did have the correct address on his driver ' s license at the time of the stop. Ensign, Anthony Todd Charged with no insurance; No 116 appearance at December 15 , 1987, arraignment; Bench warrant issued. Erickson, Robert Arthur Charged with allowing animals to 112 roam at large; Pre-Trial set for January 6 , 1988. Freitag, Daniel Dean Charged with no insurance; Fine - $200.00; Jail - 5 days, 5 115 Pled guilty. days stayed one year; On condition of no same or similar offense for one year. Hadtrath, John James Charged with possession of small Fine - $100.00. 108 amount of marijuana in a motor vehicle; Pled guilty. • Ham, Timothy Dean . Charged with DWI and alcohol 112 concentration of . 10 or more (. 20) ; Pre-Trial set for January 6, 1988. Johnson, Thomas Leroy Charged with aggravated DWI and Engstrom, 11.2, 116 gross DWI ; Jury Trial set for February 23 , 1988, at 9:45 a.m. Josie, Jr. , Floyd Collins Charged with illegal use of Fine - $700.00 , $500.00 stayed 116 license plates, no insurance, one year; Jail - 90 days, 90 days DAR, giving false information to stayed one year; On conditions of no police officer, and defective same or similar offenses for one equipment; Pled guilty to year. giving false information to police officer; Other charges dismissed. Krueger , John August Charged with DWI , alcohol Fine - $700.00 , $600.00 stayed one 108 , 116 concentration of . 10 or more year; Jail - 90 days, 89 days stayed (.17) , alcohol concentration of one year ; On conditions of no .10 or more within two hours alcohol-related driving offenses and ( .17) , and failure to obey no driver' s license or insurance traffic control device; Pled violations for one year. guilty to alcohol concentration of . 10 or more; Other charges dismissed. Lee, Richard Allen Charged with gross DWI and Fine - $3,000.00, $2,500.00 stayed Engstrom, 113 revoked plates; Pled guilty to two years; Jail - 365 days, 345 days gross DWI; Other charge stayed two years; On conditions of dismissed. no alcohol- or drug-related traffic offense and no driver' s license or insurance violations for two years, completion of 100 hours of community service in lieu of fine within six months, payment of $75.00 chemical assessment fee, completion of chemi- cal dependency course at workhouse, and weekly attendance at AA for six months. Letengarver, Perry John Charged with no insurance and Fine - $200.'00; Jail - 5 days, 5 108 improperly aimed headlight; days stayed one year; On condition Pled guilty to no insurance of no insurance violations for one charge; Other charge dismissed. year. Monson, Stephen Robert Charged with aggravated DWI, DWI, Engstrom, 116 and alcohol concentration of .10 or more within two hours ( .12) ; Pre-Trial continued until February 3, 1988. O'Connell, Gary Steven Charged with DWI, alcohol concen- 114 , 115, 116 tration of .10 or more (.17) , alcohol concentration of .10 or more within two hours ( .17) , careless driving, and possession of marijuana in a motor vehicleli Pre-Trial set for January 6 , 1988. Price, Harold Alan Charged with DWI and alcohol - 108 concentration of .10 or more within two hours .( .17) ; Pre-Trial set for January 6, 1988. Raisanen, Richard Ray Charged with misdemeanor speeding; 112 No appearance at December 16 , 1987, arraignment; Bench warrant issued. Reed, Clark Emerson Charged with DWI , alcohol concen- 114, 115 tration of .10 or more ( . 19) , and driver allowing open bottle; Pre-Trial set for January 6 , 1988. Ruettmann, Shawn Albert Charged with speeding and driver 113 allowing marijuana in a motor vehicle; Pre-Trial set for January 6, 1988. Ruschmeyer, Craig Clifford Charged with DAS , expired 116 driver' s license,. and expired plates; Arraignment continued until January 6, 1988. Siwek, Lisa Marie Charged with fifth degree 113 assault; Pre-Trial set for January 6 , 1988. Skeesick, Kelly Jean Charged with no insurance, Fine - $200.00; Jail - 5 days, 5 116 expired plates, and failure to days stayed one year; On condition transfer title; Pled guilty to of no same or similar offenses for no insurance charge; Other one year. charges dismissed. Soch, Paul Albert Charged with expired driver ' s Fine - $200.00; Jail - 5 days, 5 108 license and no insurance; Pled days stayed one year; On condition guilty to no insurance charge; of no same or similar offenses for Other charge dismissed. one year. Thompson, Leroy Arly Charged with no insurance; 112 No appearance at December 16 , 1987, arraignment; Bench warrant issued. Trimble, Allan Wesley Charged with no insurance and Fine - $200.00; Jail - 5 days, 5 114 giving false information to days stayed one year; On condition police officer; Pled guilty of no violations for operating motor to no insurance charge; Other vehicle without required insurance charge dismissed. for one year. West, Andrew Jonathon Charged with DWI, driving 108 without valid Minnesota driver ' s license, no insurance, and possession of small amount of marijuana in a motor vehicle; Arraignment continued until January 6 , 1988. P R E - T R I A L S - The Honorable Herbert E. Wolner DEFENDANT PLEA SENTENCE Davis, Kevan Patrick Charged with DAR- and no Fine - $200.00; Jail - 5 days, 5 112 insurance; Pled guilty to no days stayed one year; On condition insurance charge; DAR charge of no same or similar offenses for dismissed. one year. Johnson, Beverly Ann Charged with gross DWI , gross Engstrom, 113, 115 alcohol concentration of . 10 or more within two hours ( .11) , and aggravated DWI ; No appearance at December 16, 1987, arraignment; Bench warrant issued. Murphy, Frank Wilson Charged with DAR, expired regis- Fine - $100.00 ; Jail - 5 days, 5 114 tration, driving without valid days stayed one year; On condition Minnesota driver ' s license, and of no same or similar offenses for no insurance; Driving without one year. valid Minnesota driver ' s license charge amended to no insurance charge as the no insurance charge did not appear on the court calendar; Pled guilty to no insurance charge; Other charges dismissed. • Renstrom, Richard Brian Charged with DWI and alcohol 108 concentration of . 10 or more within two hours ( .13) ; Jury Trial set for January 20 , 1988, at 8 :45 a.m. Sherman, Christian Arthur Charged with gross DWI (two Engstrom, 108 offenses within 10 years) , gross DWI (2 offenses within 5 years) , aggravated DWI , and giving false information to police officer; Jury Trial set for February 4, 1988, at 1:45 p.m. Srnec, Andrea Beth Charged with DWI and alcohol Fine - $700.00, $500.00 stayed one Thoemke, 116 concentration of .10 or more year; Jail - 90 days, 90 days stayed within two hours ( .11) ; DWI one year; On conditions of no charge amended to careless alcohol-related driving offenses and driving due to Defendant' s good driver ' s license or insurance viola- prior record, cooperative tions for one year , and completion attitude, and low blood alcohol of alcohol awareness program at reading; Pled guilty to careless St. Thomas College. driving; .Other charges dismissed. J U R Y T R I A L S DEFENDANT PLEA SENTENCE Isaacson, Lyle Jay Charged with gross DWI and gross Fine - $300.00 ; Jail - 365 days, 357 Hickerson, 103, 112, 114 alcohol concentration of . 10 days stayed two years; On conditions or more within two hours ( . 12) ; of no alcohol-related driving Pled guilty to gross alcohol offenses and no driver ' s license or concentration of . 10 or more on insurance violations for two years, December 3 , 1987, before The continued attendance at AA, and Honorable Roberta K. Levy; Other completion of present aftercare charge dismissed. treatment program. r M I S C E L L A N E O U S DEFENDANT PLEA SENTENCE Truelove, Michael Allen Charged with DAR, open bottle, 108 no insurance, and possession of marijuana in a motor vehicle; This matter was transferred to the Minneapolis City Prosecutor 's office for prosection and was set for a pre-trial on October 7, 1987; There was no appearance by Defendant at that pre-trial and a bench warrant was issued; As of December 18 , 1987 , Defendant still had not made an appearance and the bench warrant remains in effect. C O M P L A I N T S DEFENDANT OFFICER CHARGE Cox, Barbara Anne Officer John MacQueen Charged with DWI and alcohol con- centration measured within two hours of driving of . 10 or more (.16) . Krois, Daniel Thomas Officer John Ohl Charged with driving after revocation. Rieger, Alan George Officer David Carlson Charged with operating motor vehicle without required insurance. Tollefson, Lisa Lynn Captain Richard Engstrom Charged with gross DWI. Officer John Ohl SALES SJJMMARY DECEMBER 1987 Store One Storg Sao Store Three Combined On Sale Off Sale On Sate Off Sale Warehouse Scales -Dec. 187 451,226.15 69,020.21 18,994.76 195,076.75 168,134.43 Sales -Dec. '86 442,638.55 38,592.14 20,694.64 1974477.67 185,874.10 Increase - $ 8,587.60 30,428.07 1,699.88* 2,400.92* 17,739.67* Increase % 0.02% '78.850 8:22%* 1.220* 9.55%* - Sales - 12 mos. 187 3,848,428.55 421,054.42 212,383.10 1,675,946.92 1,539,044.11 Sales -12 mos. '86 3,677,497.08 399,568.07 243,052.32 1,170,564.99 1,864,311.70 Increase $ 170,931.47 21,486.35 30,669.22* 505,381.93 325,267.59* Increase % 4.65% 5.38% 12..62%* 43.18% 17.450* * Decrease • • PAG 1 S T. A N T H O N Y B U D G E T R E P O R T F O R F I S C A L Y E A R 1 9 8 7 14OVEMBER 30. 1987 ACCOUNT NO. ACCOUNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATE FNCUMRE.RED BALANCE REMAIN aaaaasa=:.`aaaaaaanaaaaaaoaaaaaanaaoaaaaaaauanatanaaoaaaanansaaaaaaaaaaanaaaaanaaaaaaonaaaaannanaaaaaanaaaaaaaaaaaaasaaaasaaaaaanaaasa s GENERAL FUND a REVENUE n anaaanaaana:aaaoaaaaaanaaaaaaaaaataaaasaaaaaaaaaaaaa:na4 aaaaaaaaoaaaeaaaaanaaaaaaaaaaaar.aaaaaaaaaasaanaaaaaaaaaaraa haaaaaaaaaanasaaa TA XE S 101-30110-000 PROP TAXES C HOMESTEAD CR 924.500 .00 470,393.49 0 4549106.51- 49.12 IO1-30120-000 PENALT.INT,TAX FORF,LAND SL 1,465 .DO .00 0 1.465.00- 1CO.00 101-30140-000 AGREE TAX DES O .00 .00 0 .CO .00 TOTAL TAXES 925.965 .00 470,393.49 0 455,571.51- 49.20 LICENSES 101-31100-000 ON C OFF SALE 3.2 BEER 1:300 .00 1.300.00 0 .00 .00 101-31120-000 CIGARETTE 600 .00 575.00 0: 25.CO- 4.17 101-31130-000 DOG 300 5.00 350.50 0 50.50 16.83- 101-31140-000 14EATING 550 15.00 577.50 0 27.50 5.00- 101-31150-000 MOTOR VEHICLE STARTINS 100 .00 75.00 0 25.00- 25.00 101-31170-000 BENCH 160 .00 168.00 0 8.00 5.00- ' 101-31180-000 BOWLING ALLEY 800 .00 600.00 0 200.00- 25.00 101-31190-000 GARBAGE f. TRASH COLLECTING 500 .00 600.00 0 100.00 20.00- 101-31200-000 JUKE BOX 125 .00 100.00 0 25.00- 20.00 101-31210-000 PINBALL-AMUSEMENT DEVICES 5,300 .00 5.360.00 0 60.00 1.13- 101-31230-000 GASOLINE SERVICE STATION 750 .00 757.50 0 7.50 1.00- 101-31240-000 VENDING 275 .00 250.00 0 25.00- 9.09 101-3125C-COO WINE 250 .00 250.00 C .CO .00 101-31260-000 CLUB 0 .00 .00 0 .00 .00 101-31270-000 CONTRACTORS LICENSE. 1,400 120.00 11860.00 0 460.00 32.86- TOTAL LICENSES 12,410 140.00 12.823.50 0 413.50 3.33- PERMITS 101-32100-000 GRADE 50 5.00 114.00 0 64.00 128.00- 101-32110-000 BUILDING PERMITS 20.000 1.776.50 22,705.50 0 2,705.50 13.53- 101-32115-000 PLAN REVIEW 10.200 860.93 5.543.87 0 4.656.13- 45.65 101-32120-000 PLUMBING PERMITS 3,000 .00 1.676.00 0 1.324.00- 44.13 101-32130-070 HEATING PERMITS 4,000 115.00 3,220.50 0 779.50- 19.49 101-32140-000 GAS 50 10.00 177.50 0 127.50 255.00 101-3215C-000 EXCAVATION 100 .00 350.00 0 250.00 250.GD- 101-32160-000 CONDITIONAL USE 400 .00 100.00 0 300.00- 75.00 101-32170-000 FIRE PERMIT 5 .00 5.00 0 .00 .00 101-32180-000 OCCUPANCY 200 30.00 360.00 0 160.00 80.00- 101-32190-000 MULTI-HOUSING RF.GISTRATICN 795 .00 BR8.00 0 93.00 11.70- 101-32200-000 ALARM PERMIT 1.200 25.00 2.275.00 0 1,075.00 89.58- TOTAL PERMITS 40,000 2.822.4.3 37,415.37 0 2.584.63- 6.46 s PAGE 2 S T. A N T H O N Y R U O G F T R E P O R T F O R F I S C. A 1_ Y E A R 1 9 8 7 NOVEMiIER 30. 1987 ACCOUNT NO. ACCOUNT NAwF E4iCGETF.D CURRENT MONTH YEAR-TO-DATF FNCUM9FRED BALANCE % REMAIN. aaabaa.aat##aa#b###ea#a######aata#aaatt##tt#dt#####aaP#apa#bPddOa#Paaa7adaaab##td#dda0aa#a##gd#aa#ra#atb#Pa##aa# abaaaaataaa#a##a#bas e GENERAL FUND b REVENUE b abaPaPdaaaaaoaataadaaa#a#br#aria+as##bta#taatbad#a###aa#:aaaaaabaaaaxxaaa#aaaPaaaaaabaaaeaababaaaaaaaaaaaPaPtba#ao-•a:sz:aaaaadaaaaaa#a INTERGOVFRNMENTAL REVENUE. 101-33100-000 MAINTENANCE-STATE AID 8.000 .00 7.033.50 0 966.50- 12.08 101-332.00-000 POLICE SPECIAL 37,500 .00 46,864.00 0 . 9.364,00 24.97- 101-33400-000 STATE AID TO LOCAL GOVERN 257,450 .00 128,559.50 0 128,690.50- 50.06 101-33500-000 ST OF MINN-MOB ILE'HOME REGIS 0 .00 .00 0 .00 .00 101-33700-000 HENN CTY-ICE F. SNOW REmVL 6,757 .00 6.725.00 0 25.00- .37 101-33800-000 RAMSEY COUNTY-SWEEPING 1.300 .00 1,045.00 0 255.00- 19.62 101-33900 000 I.SD 9282 MISC SERVICES 4.000 1.980.59 7,625.34 0 3,625.34 90.63- TOTAL INTERGOVERNMENTAL REVENU 315,000 1.980.59 197.852.34 0; 117,147.66- 37.19 CHARGES FOR SERVICE 10 1-36100-000 MUNICIPAL COURT FINES 1001000 8.511.79 100.860.40 0 860.40 .86- TOTAL CHARGES FOR SERVICE 100.000 8.511.79 100.860.40 D 860.40 .86- MISCELLANEOUS REVENUE 101-38100-000 INTEREST-INVESTMENT EARNINGS 30.000 .00 .00 0 30.000.00- 100.00 101-38200-000 FILING FEES 10 .00. 10.00 0 .00 .00 1.01-38300-000 VARIANCE PERMITS 400 .00 395.00 0 5.00- 1.25 10 1-3840 0-000 WEED ERADICATION 500 .00 675.00 0 175.00 35.00 101-38500-000 SALE OF MAPS 75 7.50 90.00 0 15.00 20.00- 101-38600-000 COPIES 400 4.00 361.74 0 38.26- 9.57 LO1-38700-000 SPECIAL ASSESSMENT SEARCHES 800 10.00 759.00 0 41.00- 5.13 101-30800-000 PLAT FEES 50 .00 29.00 0 21.CO- 42.00 101-38910-000 MISCELLANEOUS 33.915 5.951.62 14.939.76 0 18,975.24- 55.95 TOTAL MISCELLANEOUS REVENUE 66.150 5,973.12 17,259.50 0 48,890.50- 73.91 OTHER SOURCES 1.01-39a30-000 LIQUOR FUND 300,000 .00 75,000.00 0 225.000.00- 75.00 101-39980-000 REVENUE SHARING FUND 25.000 .00 .00 0 25,OOC.00- 100.00 101-39990-000 TRANSFERS 0 .00 .00 0 .00 .00 101-3990-000 RESERVES 0 .CO .00 0 .00 .00 TOTAL OTHER SOURCES 325.000 .00 75.000.00 0 250,CCO.00- 76.92 TOTAL GENERAL FUND 1.784,525 19,427.93 911.604.60 0 872,92^.40- 48.92 PAGE • 3 S 1'. A N T H O N Y B 11 0 G F T R E P O R T F O R F I S C A L Y E A R 1 g 8 7 NOVEMBER 30, 1987 ACCOUNT NO. ACCOUNT NAMIE RIIOGFTED CURRENT MONTH YEAR-TO--DATE FNCUMRERED BALANCE Z REMAIN II?#OhII#IIO#hII#a#a#i!###II##IIC#tIIt####!i###O?#pIIII#!a0#4##a###$#h#$$aloha!#a$$#O#.#3?!#lhaF#CA!?II?IIhnIIII#?##!#II#aila##?#$!9h#!##04#C#!h#II i # GENERAL FUND # EXPENSES # MAYOR - COUNCIL aa#!#�a#�a#gr•a#a$#oa#.!II#II#ahsIIaII#ha##!!a#ae##aea?IIaoa#a�a#saa!$$$##a?a#aalaaaoa#!!ak!$aIIaaa$hee$aaoralhII##?a#CSeu$#a?II#:taa#!aa##ss , PERSONAL SERVICES 101-40100-110 - SALARIES 12,900 1,175.00 12,600.00 0 =00.00 2.33 101-401CO-112 SALARIES-TEMP/PART TIME 3,400 409.60 4.990.40 C 1.590.40- 46.78- TOTAL PERSONAL SERVICES 16,300 1,584.60 17,590.40 0 1,290.40- 7.92-' CONTRACTUAL SERVICES 101-40100-226 GENERAL SUPPLIES 50 .00 10.75 0 39.25 78.50 TOTAL CONTRACTUAL SERVICES 50 .00 10.75 0 39.25 78.50 SUPPLIES 101-40100-320 CONSULTING CGNTRACTED SVC. 14,400 .00 11.899.75 0 2,500.24 17.36 101-40100-321 OTHER SERVICES 50 .00 .CO 0 50.00 100.00 101-40100-341 TRAVEL CONFERENCE G SCHOOL 8.000 51.30 4.189.38 0 3,810.62 47.63 101-40100-342 SUBSCRIPTIONS L MEMBERSHIP 50 .00 10.00 0 40.00 80.00 TOTAL SUPPLIES 22,500 51.30 16,099.14 0 6,400.86 28.45 SUPPLIES 101-40100-671 CONTINGENCY FUND 6.250 1,195.50 5,789.92 0 460.08 7.36 TOTAL SUPPLIES 6,250 1.195.50 5.789.92 0 460.08 7.36 TOTAL MAYOR - COUNCIL 45,100 2,831.40 390490.21 0 5.609.79 12.44 I i i I I PAGE 4 S T. .•, N T H O N Y B U D G F T R E P O R T . - F n R F I S f, A L Y E A R 1 9 8 7 NOVEMBER 30, 1987 ACCOUNT NO. ACCOUNT NAME Bl10GFTF0 CURRENT MONTH YEAR-TO-DATF ENCUMPERED BALANCE $ P.EMAIY. ##nar#nin#a###t#n4#nn##a#4#II#4##ia#Oin##a###in4n#####i#t4#E4#na#a####a#naua4#Raa#a4id##aa#a#i4rf4a#40#itrirr#b#4#=####7s7##n9#a4#saar s GENERAL FUND # EXPENSES ¢ GENERAL MANAGEMENT naaaaraaa##4a#ar#ur4#a##rrrrs##ns###isr#anr##aarrnesaaa#oax:n##ns#s#sssasaaaa#assaasssa#aatsa#s###u##assssi4sa#oasaaasse#ssi#a#un#rrs PERSONAL SERVICES 101-40200-110 SALARIES REGULAR 57.950 5.717.41 58.744.43 0 794.43- 1.37- 101-40200-114 EMPLOYERS CONTRIB/PENSIO N 6.650 687.39 7.243.30 0 593.30- 6.92- 101-40200-115 EMPLOYERS CONTRIB/TNSUR 3.400 181.50 2,584.57 0 815.43 23.98 TOTAL PERSONAL SERVICES 68,000 6.586.30 68.572.30 0 572.30- .84- SUPPLIES 101-402CO-320 CONSULTING/CONTRACTED SER 1.800 641.55 3,826.50 0 2,026.50- 112.5E- 101-40200-321 OTHER SERVICES 100 12.50 207.45 0 107.45- 107.45- 101-40200-341 TRAVEL CONFERENCE E SCHOOL 3.000 2.34.77 3.189.57 0 189.57- 6.32- 101-40200-342 SUBSCRIPTIONS C MEMBERSHIP 600 45.00 607.73 0 7.73- 1.29- 101-40200-349 MISC EXPFNSES - HRA 0 .00 .00 0 .00 .00 TOTAL SUPPLIES 5,500 933.82 7.831.25 0 2,33'•_.25- 42.39- TOTAL GENERAL MANAGEMENT 73.500 7,520.12 76.403.55 0 2.903.55- 3.95- 0 • PAGE 5 S T. A N T H O N Y B U D G E T R F, P 0 R T F O R F I S C A L Y E A R 1 9 8 7 NOVEMBER 30. 1987 ACCOUNT NO. ACCOUNT NAME Bt1DGETFD CURRENT MONTH YEAR-TO-OATF FN:CUMVFP ED BALANCE % RE-AIN uaoaaaaeaaaaaaaeasaacaaaaasaaaaaaasseeoeeseasaeaaeoaeaeaaasaeaeaasaaaaaaeesaaaaaasaeeasaaaaeaaaaeseasasseaaaeeaaaeaa�aasassssaas as a GENERAL FUND a EXPENSES - ELECTIONS aaaaaaaaaaaaaaaaaeaaavraaaaar•aeaeaaaaasassaaaasaaaeeseaaoasaaeaaaasaaaasesaaaaasaeassaaaasaeassansaasaaaasaanaaaasaaaa'soaaasaaessaaa PERSONAL SERVICES 101-40400=11.2 SALARIES - TEMP/PART TIME 800 782.00 782.00 0 18.00 2.25 TOTAL PERSONAL SERVICES B00 782.00 782.00 0 18.00 2.25 CONTRACTUAL SERVICES 101-40400-226 GENERAL SUPPLIES 200 .00 96.87 0 103.13 51.57 TOTAL CONTRACTUAL SERVICES 200 .00 96.87 0 103.13 51.57 SUPPLIES 101-40400-334 PRINTING L PUBLISHING 509 .00 172.42 0 327.5P. 65.52 10i-40400-337 HAINT L REPAIRS - OTHER 100 .00 14.98 0 85.02 85.02 TOTAL SUPPLIES 600 .00 187.40 0 412.60 68.77 TOTAL ELECTIONS 1.600 782:00 1.066.27 0 533.73 33.36 • 0 PAGE 6 . S T. A N T H O N Y B U D G E T R E P O R T F O R F I S C A L Y E A R 19 8 7 NOVEMBER 30, 1987 ACCOU.'JT NO. ACCOUNT NAME DUDGFTFD CURRENT MONTH YEAR.-TO-DATE. ENCUMBERED BALI.tiCE S REMAIN aaaaaaa¢aeoa¢¢e¢a¢aaaaa*aaanoa*oon*o¢aanaaaoaoana¢aaaasaa*a*aaQaastaacaaaaas¢aaaaaas: ¢aaaata¢aa*staata¢aseoo*caeaoar-aessnaaaoaas**a¢ a GENERAL FUND ¢ EXPENSES a FINANCE/INSURANCE/ACCOUNTING aQ¢¢taoaaaFai+QaQan3¢¢a*t¢*taaaaaQQaaaaQQ¢Qfifie¢aa¢aa¢¢t*ea¢aaaaa¢a¢aaatQQ*aa¢aaQ�daaQaaaaQQaa*aQaaa*aa¢4aaQL'a¢aaaaQfiQaa;aaeRaQeQea¢aa PERSONAL SERVICES 101-40510-110 SALARIES REGULAR 26.450 2.449.54 25,023.18 0 1.426:82 5.39 101-4D510-112 SALARIES - 1F.MP/PART TIME 0 .00 .00 0 .00 .00 101-4D510-114 EMPLOYERS CONTRIB/PFNSION 3.125 176.41 3.309.63 0 184.63- 5.91- 101-40510-115 EMPLOYFRS CONTRIB/INSUR 1.825 71.45 1.070.29 0 754.71 41.35 TOTAL PERSONAL SERVICES 31.400 2,697.40 29.403.10 0 1,596.90 6.36 CONTRACTUAL SERVICES 101-40513-220 OFFICE SUPPLIES 5.700 47.86 5,423.13 0 276.87 4.86 101-40510-226 GENERAL SUPPLIES 300 .00 .00 0 300.00 100.00 TOTAL CONTRACTUAL SERVICES 61000 47.86 5,423.13 0 576.87 5.61 SUPPLIES 101-40510-320 CONSULTING/CONTRACTED SER 10.950 .00 10,418.73 0 531.27 4.85 1.01-40510-321 OTHER SERVICES 2.135 505.81 1.994.17 0 140.83 6.6C 101-40510-334 PRINTING E PUBLISHING 500 .00 679.94 0 179.94- 35.99- 101-40510-335 INSURANCE 116,700 4,973.00- 105,679.91 0 11,020.09 9.44 101-40510-'339 MAINT E REPAIRS/EOUIPMENT 2.50 .00 .00 0 250.00 100.00 i01-40510-341 TRAVEL CONFERENCE E SCHOOL 865 33.50 620.80 0 244.20 28.23 101-40510-342 SUBSCRIPTIONS E MEMBERSHIP 6,550 .00 6,460.45 0 39.55 1.37 10L-110510-349 MISCELLANEOUS EXPENSES 200 .00 126.35 0 73.65 36.83 TOTAL SUPPLIES 138,150 4,433.69- 125,980.35 0 12,1:9.65 8.81 TOTAL FfNANCFlINSURANCE/ACCTG 175.550 1,688.43- 160.806°58 0 14,743.42 6.40 v r PAGE 7 S T. A N' T H 0 N Y B U D G E T R E P O R T F O R F I S C A L Y E A R 1 9 8 7 NOVEMBER 30, 1987 ACCOUNT Nil. "ccnijNT W F DUDGETEn f.URPFNT MONTH YEAR-TD-f?ATE FNCUNBFREC 94LANCE REMAi`J *aa¢aaaR¢acab4aa RaFaaaa¢OtL*tu4¢a*babes*Of a4taCaat-aOdFJ¢a94:Caaaa4II¢Mad*¢+P4**Pa#*#aGfat#b##¢R4b i4*04F*bbb*#*¢04*is¢OQ#4#C¢#0a kf*acaa * GENERAL FUND ¢ EXPENSES a FINANCE-ASSESSING . abtt¢eaaaccbaacaMac:aaa¢a;osc¢abbbacaacaaaabcb+safcat¢cab#a¢a#a¢,:a*tracao#*c¢¢aaaaaa#r•**aa*aacaaab4aa4aa4c*ataaaubap4�raAa¢*#*a*#***¢* PERSONAL SFPVICFS 101-40530-110 SALARIES REGULAR 975 74.70 937.35 0 37.65 3.86 101-40530-114 EMP CONTR-PENSION 120 1.64 126.66 0 6.66- 5.55- 101-40530-115 EMP CONTR-INSURANCE 105 1.80 9.0.08 0 14.92 14.21 TOTAL PERSON'L SERVICES 11200 78.14 1,154.09 0 45.91 3.83 CONTRACTUAL SERVICES 101-40530-226 . GENERAL SUPPLIES 50 .00 .00 0 50.00 100.00 TOTAL CONTRACTUAL SERVICES 50 .00 .00 0 50.00 100.00 SUPPLIES 101-40530-320 CONSULTINGiCONTRACTCD SER 20,350 .00 24.611.60 0 4,261.60- 20.94- 101--40530-321 OTHER SERVICES 130 .00 100.80 0 29.20 22.46 101-40530-334 PRINTING F. PUBLISHING 20 .00 .00 0 20.00 100.00 TOTAL SUPPLIES 20,500 .00 24,712.40 0 4,212.40- 20.55- TOTAL FINANCE- ASSESSING 21,750 78.14 25,866.49 0 4,116.49- 18.93- op _ PAGE P S T. A N T H 0 N Y B U D G E 7 R E P O R F C R F I S C A L Y E A R T 9 P 7 NOVEMBER 30, IQ97 4CCOUNT NO. ACCOUNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATE E NIC U MR EP.ED 3ALANC.E $ REMAIN t##p#a#k>ipaF4asFppkapFa#fi p F F F F p F p a p a p a a t#+Faa 0,****4 F akapp#aFtF##ptp#FaSa#aapFp pp##ap###pba tpa##pba>aaaapaFaFa4P###ataaaka i4FUpF#FF GENERAL FUND .'+ EXPENSES a LEGAL tRaa aaakspakk:�#?a43#Fka##Cpp pfi atFppp4fi tk aapaapaaFi�at4FF#tat#>}#Ftp#'�ra40##4#p0attaIIpG##p##p#Fop###FF#p.'�#hpppp##pt#3k#F�6,#tpat3##p#aT SUPPLIES 101-40600-320 GENERAL LEGAL 8.000 .00 6,021.90 0 1,978.10 24.73 . 101-40600-322 PROSECUTIONS 24.000 2.200.00 16,836.28 0 7,163.72 29.85 TOTAL SUPPLIES 32.000 2.200.00 22.858.18 0 97141.82 28.57 TOTAL LEGAL 32.000 2,200.00 22.858.18 0 9.141.82 26.57 j PAGE S T. A N T H 0 N Y 8 0 0 0 E T R E P O R T F O R F I S C A L Y E A R 1 9 8 7 NGVEMSER 30. 1987 ACCOUNT tJ^. ACCOUNT NAME BUDGFTED CURRENT MONTH YEAR-TO-OATF FNCUMBERED BALANCE FEM'!V aaasaoannraaasaa: eaaaaaaaaaaasaaaaaaanaaaaennsasnaaaaaanaaaasa=a aaasea�sesessnaassaasssasaaasasaaaaaaasoaaaaaanaasnaasnaseasaaasxana s GENERAL s EXPENSES a ENGINEERING/PLANNING/ZONING anaanaa4daaanaaaasaaaaaaaasananaaanaanannananasn�aaanaaaaaaanasaesasatnanssneaasaseasacnnanaaasanaaassasoasanaasaaasnasaanaaaanc:asa CONTRACTUAL SFRVICES 101-40700-226 GENERAL SUPPLIES 200 .00 1.97 0 198.03 99.02 TOTAL CONTRACTUAL SERVICES 200 .00 1.97 0 198.03 99.^2 SUPPLIES 101-40700-320 CONSULTING/CONTRACTED SER 3.000 .00 449.96 0 2.550.04 05.00 101-40700-334 PRINTING E PUBLISHING 350 .00 247.44 0 102.56 29.30 101-40700-341 TRAVEL-CONFERENCE-SCHOOLS 100 5.00- 229.00 0 129.00- 129.00- 101-40700-342 SUBSCRIPTIONS G MEMBERSHIPS 50 .00 .00 0 50.00 100.00 TOTAL SUPPLIES 3.50^ 5.00- 926.40 0 2.573.60 73.53 TOTAL ENGINEFRING/PLAN/ZONING 3.700 5.00- 928.37 0 2.771.63 74.91 i OS'6Z 176'908'8Z 0 90'E178189 -ZL'OZS'11 OS9'L6 SJN10lif1U A113 -iviui -.".•9'9 -OO'E£ 0 001EES -00'00011 005 S3SUJdX3 lVlldy7 Mill -0919 -00'EE 0 00°EfS -00'00011 00; iN3Wdif103 3 Ab3NIH3Vn £517-OS6017-101 S3SN3dX3 1V11dV3 02'1: Z9117681SZ 0 8£'S01'LS -ZL'OZ9'01 000'E8 S31lddflS 17101 -L5'LS -00'TL8'I O 00'IZI•S -9E'68's'ZI USZ'E JNIOl1f18/SaIVd3'd '1 1NIVW 04E-056017-101 LT.'19 4h'ISE181 0 9S'84Y9111 ZE'016 000'OE S311111In 9EE-05604-101 178'L 179'106 0 9E'86S'01 ZE'OZb 005'11 SNOIlV3INf1WW03 IEE-OS60h-10T SS'6E 49'962 0 9E'ES17 00' OSL S331na3S 53H13 IZE-056017-101 T6'TZ 06'SlZ'8 0 01148Z'6Z 0010£1 005'LE b3S (1313Vb1NU3/JN11-ins NO3 OZE-056017-IOl S3llddAS 6E'L 06'011 0 01'68E'1 00' 00511 S331I1b3S 1Vi113751NO3 1U.01 6E'L 06'011 0 01'68E'l 00' 005.1 S31lddflS 1V53N3J 92Z-09605-107 S331Ad3S 1vni:m1NO3 131ZZ Z17117E8'Z 0 SS'S78'6 00' GS9'Zl 533Inb3S 'IVNUS83d lV1Ol 5819E 81'117? 0 Z8'914 00' 099 bf1SNI/0151NO3 S53AOldW3 511-056017-101 6E'Z 89'6Z 0 ZE101Z'1 00' 04Z'I NCISN3d/8181N00 S53AUldW3 17TT-0S6017-101 00' 00' 0 00' 00' 0 S 31 bV lVS 3W I1 53110 l T 1-0 56017-107, ES°EZ 9SI79SIZ 0 49'88l`8 00' OS1'01 bvlf1J35 S315V'lVS 011-056017-101 S331Ad3S IVNOS83d sttaaa¢¢¢¢¢**saoaa¢aa¢t*aeaassaa¢*¢a¢ta¢a¢*aaaasstaaataa¢¢aaaaaa¢¢a*aao***¢aoa***aa¢aa¢a¢t¢*aaaaaaaaa¢*s¢¢¢¢a¢a¢aasaa¢ea¢¢a¢aosae¢oa SJNI0llf18 A113 a S3SN3dX3 ¢ 1V53N39 a a:seaat¢¢¢ataoa.s¢aaaaaaaataaaaa¢aaea*as¢*at¢a*¢tsac*asa¢a*aaaatat*aaaaaaaeste*aa¢*aaaaaaaa¢sasasataa*as*¢aaaaa�aadat¢aaasaa�sasas a*aa NIVW38 B 33N71Vv 03538Wf1]N3 31VU-01-bV3A H1NJW 1N3dbf13 U313JOf10 3r;rN 1Nf1U33v 'ON 1NnoD:)v L861 'OE b38W3AON L 8 6-._,1 b V 3 A l v 3 S l 3 5 U 3 ' 1 b U d 3 5 1 3' J O fl 8 - A N 0 H 1 N V '1 S O7 39Vd PAGE it S T. A N I H O N Y B U 0 G F T R E P O R T F A R F I S C A L Y E A R 1 9 8 7 NOVEMBER 30, 1987 ACCOUNT NO. 4ccn.UNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATF. ENCUNRERED RALANCE a REMAIN aaaaaataaaacaaaaa�r.a�aasoaaaaa.zsaaaaaaat.arsasaaaaaaaaaaeaaaaeosso4aaaoaasas. aaeaaacaaaaeaacaa*arataaeaeaaaoaanaaasaeoessaeaaaaeaaeae a GENERAL a EXPENSES a CIVIL DEFENSE ataaaaaaaaasos�eaaaaacsaaaasaaaaoaaaaaaasaaaeaaaaaadaaaaaaaaaaaaaaaaaaaaaaasaaaaaaaaasaaaaaaaaaavar.xxaaa::taaaeae,tsaaaa'coaaaaoaaaaoat PERSONAL SERVICES 101-41000-110 SALARIES REGULAR 18.125 1.413.46 16.316.69 0 1,808.31 9.95 101-41000-114 EMPLOYERS CONTRIS/PENSION 2.450 347.56 2.133.53 0 316.47 12.92 101-41000-115 EMPLOYERS CONTRI'B/INSUR 1.125 239.10 889.30 0 235.70 20.95 TOTAL PERSONAL SERVICES 21.700 2.000.12 19.339.52 0 2.360.48 10.88 CONTRACTUAL SERVICES 101-41000-226 GENERAL SUPPLIES 300 .00 39.95 0 260.05 86.68 TOTAL CONTRACTUAL SERVICES 300 .00 39.95 0 260.05 65.68 SUPPLIES 101-41000-331 CCMMUNICATIONS 1.175 15.70 207.00 0 968.00 82.36 101-41000-334 PRINTING E PUBLISHING 200 .00 100.00 0 100.00 50.00 101-41000-339 MAINT E REPAIRS/EQUIPMENT 150 .00 41.30 0 108.70 72.47 101-41000-341 TRAVEL CONFERENCE L SCHOOL 2,685 .00 196.00 0 2.489.00 92.70 TOTAL SUPPLIES 4,210 15.70 544.30 0 3,665.70 87.07 CAPITAL EXPENSES 101-41000-453 MACHINERY E EQUIPMENT 2,040 .00 182.00 0 1,858.00 91.06 TOTAL CAPITAL EXPENSES 2.040 .00 182.00 G 1105R.00 91.08 TOTAL CIVIL DEFENSE 28.250 2,015.82 20.105.77 0 E,144.23 28.53 E., PAGE 12 S I. A N T H 0 N Y 6 U D G F T R E P O R T F O R F I S C 4 L Y E A R 1 9 8 7 NCVFMP.ER 30, 1987 ACCOUNT NO. ACCQIJNT NAME BUDGETED CURRENI MONTH YEAR-TO-DATE. F.NCUMPFRED BALANCE % REMAIN ¢a¢aaaaaa¢aaa¢aaaoa::ua¢aaoaaoaa¢aoaxoaaassa¢ca¢aasasaasaaaaaaaaaaaaaaasaaaaaraaaasasaaaassaaasasa+aarbaaaaaaasaaar•a¢aaassvasaaaaaaasa ¢ GENERAL ¢ EXPENSES ¢ POLICE PROTECTION ¢aaa#¢aae¢COa aCFaLaEK7Ca3tCSaaaaS¢¢aCIItaaaOaaF4attaa¢¢aaoaaa0aa¢iaaa6ataaCa¢+C4�Pa�VPO¢OOa4aaA#g4a#aaRa¢aA;kRaO#¢aPaOa¢4R¢fiFEa g+¢a�Paa¢ PERSONAL SERVICES 101-41100-110 SALRIES REGULAR 416,000 40.926.20 366.891.77 0 49,108.23 1.1.80 101-41100-111 OVERTIME 81000 690.82 9,667.89 0 1,667.89- 20.85- 101-41100-113 SALARIES P T - SECY 3,400 .00 1.759.00 0 1,641.00 48.26 101-41100-114 EMPLOYERS CONTRIB/PENSION 55,900 5.403.51 48.396.82 0 7.503.18 13.42 101-41100-115 EMPLOYERS CONTRIB/INSUR 27.100 1,883.15 18,078.52 0 91021.48 33.25 101-41100-117 0/1 COURT 2,600 .00 3.097.61 0 497.61- 19.14- TOTAL PERSONAL SERVICES 513,000 48,903.68 447,891.61 0 65.108.39 12.69 CONTRACTUAL SERVICES 101-41100-226 GENERAL SUPPLIES 8,365 322.75 768.92 0 7.596.08 90.81 TOTAL CONTRACTUAL SERVICES 8.365 322.75 768.92 0 7,596.08 90.81 SUPPLIES 101-41100-321 OTHER SERVICES 6,500 217.76 5.251.83 0 1,248.17 19.20 101-41100-331 COMMUNICATIONS 9.200 101.99 574.31 0 8,625.69 93.76 101-41100-333 CARE PRISONERS/BKING FEES 14.000 1.227.66 12,530.37 0 1,459.63 10.50 101-41100-334 PRINTING E PUBLISHING 2,300 .00 19355.40 0 544.60 41.07 101-41100-339 MAINT E REPAIRS/EOUIPMFPJT 640 254.40 450.40 0 189.60 29.63 101-41100-341 TRAVEL CONFERENCE E SCHOCL 21050 415.00 1,477.65 0 572.35 27.92 101-41100-342 SUBSCRIPTIONS F. MEMBERSHIP 690 27.25 292.50 0 397.50 57.61 TOTAL SUPPLIES 35.380 2.244.06 21.932.46 0 13,.447.54 38.01 CAPITAL EXPENSES 101-41100-454 FURNITURE E FIXTURES 3.005 .00 1.472.55 0 1,532.45 51.00 TOTAL CAPITAL EXPENSES 3,005 .00 1,472.55 0 1,532.45 51.00 TOTAL POLICE PROTECTION 559,750 51,470.49 472.065.54 0 87,584.46 15.66 PAG` 13 S T. A N T H O N Y P. 11 D G E T R E P O R T F O R F I S C A L Y E A R 1 9 8 7 NOVEMBER 30, 1987 AC-,OUNT NO. ACCOUNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATE FNCUN9FRED BALANCE X REMAIN #aaas##pso#ap#aapaaaxa#ac ##aasaaasaasa#33333#ppasaaa#a##a#aaasccaaas##aaaasaaptaaaaspsakr.###snap#sa*asax##oaaaaa4acpaasaaapaaaaaaat a GENERAL a EXPENSES - FIRE PROTECTION pfi pppaaaa#�aaspas#aa#aaasaa#anaaaapappap p#pa#a##aatpaap###aaapOrCaaap#paaaapa#a#p#aaoaaaaa a:#as#a#ss#a#sppaPLa4paa#ap##aeaaOC###a#saa PERSONAL SERVICES 101-41200-110 SALARIES REGULAR 198.000 21.320.56 177.795.63 0 20,204.37 10.20 101-41200-111 OVERTIME 14,000 1,666.48 15.963.33 0 1,963.33- 14.02- 101-41200-112 SALARIES - TE,MPIPART TIME 35.000 796.50 25.168.19 0 9.831.81 28.09 L01-41200-114 EMPLOYERS CONTRIB/PENSION 28.600 2.774.91 25,075.39 0 3,524.61 12.32 101-41200-115 EMPLOYERS CONTRIB/INSUR 15.900 1.287.25 12.590.59 0 3.309.41 20.81 TOTAL PERSONAL SERVICES 291.500 27,845.70 256.593.13 0 34,906.87 11.97 CONTRACTUAL SERVICES 101-41200-225 FIRE PREVENTION SUPPLIES 1,525 68.58 726.64 0 798.36 52.35 101-41200-226 GENERAL SUPPLIES 5.985 85.00 3.879.98 0 2.105.02 35.17 TOTAL CONTRACTUAL SERVICES 7,510 153.56 4,606.62 0 2.903.38 38.66 SUPPLIES 101-41200-320 CONSUL TING/CONTR ACT EO SER 1.600 205.32 309.27 0 1.290.73 80.67 101-41200-321- OTHER SERVICES 3.990 139.51 2.814.92 0 1,175.06 29.45 101-412 00-331 COMMUNICATIONS 2,325 .00 136.94 0 2.188.06 94.11 101-41200-339 MAINT E REPAIR/EQUIPMENT 1.035 .00 119.90 D 915.10 88.4-1 101-41200-341 TRAVEL CONFERFNCE E SCHOOL 2.465 .00 2,061.07 0 403.93 16.39 L01-41200-342 SUBSCRIPTIONS F. MEMBERSHIP 865 .00 776.20 0 89.80 10.27 TOTAL SUPPLIES 12.280 344.63 6,218.30 0 6,061.70 49.36 CAPITAL EXPENSES 101-41200-453 MACHINERY L EQUIPMENT 6.225 385.98 5.624.69 0 600.31 9.64 TOTAL CAPITAL EXPENSES 6.225 385.98 5,624.69 0 600.31 9.64 TOTAL EIRE PROTECTION 317.515 28.730.09 273,042.74 0 44,472.26 14.01 PAGE 14 S T. A N T H 0 N Y B 0 0 0 E T R E P O R T f! O R F I S C A L Y E A R --1 9 8 7 NOVEMBFR 30, 1967 ACCOUNT ND. ACCOUNT "JAPE BUCGETEO CURRENT MONTH YEAR-TO-DATE ENCUMP.FP.ED BALANCE Z REva IN aaa;�sasaaaaaaasaataataaasaaaaaaaaaaaaaaadaaaasaatasaaaaataaaaaasaeaasnaaaaaaatesaaaaaasat�aota�aaasaaaaxusteaaaaaaaaaaaaawaaaaaastoa s GENERAL a EXPENSES a INSP-BLDG/PLBG/HTG/HEALTH acaaaaaaaataaaaaaaataaaatataaaaaaanasaaaaeaaatatataaeaasasaastaaaattasaaeataaasaasataaeamaar.aaaaaaaaasaaaaaaaeaaoaaaoassaaaaaaatsata PERSONAL SERVICES 101-41300-110 SALARIES REGULAR 7,670 613.84 6.835.44 0 834.56 10.88 lOt-41300-112 SALARIES-TEMP/PART TIME 0 .00 .00 0 .00 .00 101-41300-114 EMPLOYERS CONTRIB/PENS[ON 890 62.50 882.72 0 7.28 .82 101-41300-115 EMPLOYERS .CONTRIB/INSUP 440 95.00 433.76 0 6.24 1.42 TOTAL PERSONAL SERVICES 9.000 771.34 8.151.92. 0 848.08 9.42 CONTRACTUAL SERVICES 10t-41300-226 GENERAL SUPPLIES 100 .00 101.20 0: 1.20- 1.2C- TOTAL CONTRACTUAL SERVICES 100 .00 101.,20 0 1.20- 1.2C- SUPPLIES 101-41300-320 CONSULTING/CONTRACTED SERV 2.425 .00 2.310.00 0 115.00 4.74 101.-41300-334 PRINTING E PUBLISHING 150 .00 .00 0 150.00 100.00 101-41300-341 TRAVEL CONFERENCE. C SCHOOL 200 .00 .00 0 200.00 100.00 101-41300-342 SUBSCRIPTIONS 1. MEMBERSHIP 125 30.00 100.00 0 25.00 20.00 TOTAL SUPPLIES 2.900 30.00 2.410.00 0 490.00 16.90 TOTAL IN-BLDG/PLBG/HTG/HEALTH 12.000 801.34 10.663.12 0 1.336.88 11.!4 L PAGE 15 S T. A N T H O N Y B U D G F T R F P n R T f f. R F I S C A L Y F A R 1 9 8 7 NOVEMBER 3C. 19P.7 ACCOUNT NO. ACCOUNT NARF P.UDGFTFD CURRENT MONTH YEAR-TO-DATE FNCUMPEREC BALANCE °. REMAIN aaaaaaaaaa*a*aaaaaaaa*a*aacazacaaacaeaaeaa#aaaaaaaa•aaaaasaa*aaaaaaaaoa*araaaaaaeaoaa*oaaaa*aa**aaaaaaa**anaaoa.'aaaaaaaa+�axa*aasa�+aa a GENERAL - FXPENSF.S o ANIMAL CONTROL aaaaaaaaan=ara*aaaoataaaoa*aaaaaa*tsaasaaaacaaaaaaaasa*aaaaoaoax,�eaaaa**xr.**g*.+aa*ate*aa*acaaaaanar.er.�*a*aaeaaa*osaaaac'**aaasea*tiaeoc CONTR&CTUAL SERVICES 101-41900-226 GENERAL SUPPLIES 50 .00 106.80 0 56.80- 113.60- TOTAL CCNTRACTUAL SERVICES 50 .00 106.80 0 56..80- 113.6C- SUPPLIES 101-419OC--320 CONSULTING/CONTRACTED SER 600 .CO 693.70 0 93.70- 15.62- TOTAL SUPPLIES 670 .00 693.70 0 93.70- 15.62- TOTAL ANIMAL CCNTROL 650 .00 800.50 C 150.50- 23.15- PSGE 16 S T. A N Y H 0 N Y 8 U D G E T R F. P 0 R T _ F O R F I 'S C A L Y F A R 1 9 8 7 NOVEMBER 30. 1987 ACCOUNT NO. ACCOUNT NAMF BUDGFTFD CURRENT MONTH YFAR-TO-OATF FNCUMnERED B&LANCE REMA1N saaorooaoaoaarsaraataaosssoaoaaaaaaaaoaaoaaoaaoaaaaaoaaoasaaaooaoa r aboaa000aa aarasrcnaocaaoaanaaar•000 argaaaaaaoaraoatrcoac�vaaaoaaa a GENERAL o EXPENSES o PUBLIC WORKS oaoaaaecasasoaoaascoaoasoaoaeaoa:oaroaaao:aaoaraoaaoaareaaeoaaaoateaoeozaoaaoraaaaorarcaa saaaraosaaaaooaaaaoaaraaacar�a zaaaoaaoosomr PERSONAL SERVICES 101-42000-110 SALARIES REGULAR 128.000 11.671.70 117,416.50 0 10,583.50 0.27 101-42000-111 OVERTIME 4,000 50.85 1,065.91 0 2,934.09 73.35 101-42000-112 SALARIES-TEMP/PART TIME 16.000 .00 12,671.00 0 3,329.00 20.81 101-42000-114 EMPLOYERS CONTRIB/PENSION 15.500 1.187.84 14.534.10 U 965.90 6.23 101-42000-115 EMPLOYERS CONTRIB/TNSUR 10,500 779.15 6,802.63 0 1.697.37 16.17 TOTAL PERSONAL SERVICES 174,000 13,689.54 154.490.14 0 19,509.86 11.21 CONTRACTUAL SERVICES 101-42000-223 SMALL TOOLS 200 .00 125.13 0 74.87 37.44 101-42000-224 STREET SIGNS 3,800 82.74 x61.86 0 2,930.14 77.32 101-42.0OG-2.26 GENERAL SUPPLIES 50.000 871.64 26,339.57 0 23.650.43 47.32 TOTAL CONTRACTUAL SERVICES 54,000 954.58 27.326.56 0 26,673.44 4rj.40 SUPPLIES 101-42000-321 OTHER SERVICES 1.400 199.40 1,300.70 0 99.30 7.09 101-42000-336 UTILITIES-STREET LIGHTS 34.600 2,353.37 24,844.72 0 9,755.28 28.19 101-42000-338 RENTALS 200 .00 .00 U 2CO.0fi 100.00 101-42000-339 MAINT L REPAIRS - EOUIP 7,300 .00 5,078.65 0 2,221.35 30.43 101-42000-341 TRAVEL-CONFERENCE-SCHOOLS 300 13-50 230.20 0 69.80 23.27 101-42000-342 SUBSCRIPTIONS L MEMBERSHIPS 60 .00 82.00 0 22.00- 36.67- 101-42000-349 MISC. EXPENSES 300 .00 108.28 0 191.72 63.91 TOTAL SUPPLIES 44,160 2.566.27 31,644.55 0 i2.515.45 28.34 TOTAL PUBLIC WORKS 272.160 17.210.39 213.461.25 0 58,698.75 21.57 i PAGE 17 S T. A N T H O N Y 9 U 0 G F T R E P 0 R T F 0 P, F I S C A L Y E A R 1 9 8 7 NOVEMBER. 30, 1987 ACCOUNT N.O. ACCCUNT f:A^!f' BUDGETED CURRENT MONTH YFAP.-TO-OATF. E:`CU'iP.FRFD BALANCE % RENNIN xatasa a$aaaae oaaa asaaac aaea uaae aoaao t•a'aaaa aasaaaa noaaaeaaaeaaotaeaaaaaaapaaaaaaa at+asaaaaaaascaaet t aaaaaacsaaoaaaoaasaaaacaaaacaaa a GENERAL a EXPENSES a PUBLIC WORKS-MAINT/REPATR EO xaaaCOta�aaa0aa#acat•CaCaata#aaaos aeataeaaaaSaaaaaaa4aa#t:aaaa0aabaaa9aab7#aa0 Mt:3a�iiAaaat.ix4aa73 sa0taaaaaataRta:.aiCata ar:fi aa4aa0asaaac PERSONAL SERVICES 101-42200-110 SALRIES REGULAR, 26,500 1.993.95 20,280.41 0 6,219.59 23.47 101-422CO-ll! OVERTIME 500 .00 129.96 0 370.04 74.01 101-42'200-114 EMPLOYERS CONTRIB/PENSION 3,150 278.91 2.578.15 0 571.85 18.15 101-42200-115 EMPLOYFRS CONTRIB/INSUR 2.150 106.35 948.15 0 1,201.85 55.90 TOTAL PERSONAL SERVICES 32.300 2.379.21 23,936.67 0 8.363.33 25.89 CONTRACTUAL SERVICES 101-42200-222 MOTOR FUEL E LU3RICANTS 32.000 . 00 12,190.75 0 19,809.25 61.90 101-42200-223 SMALL TOOLS 400 .00 598.54 0 198,54- 49.64- 101-422.00-226 GENERAL SUPPLIFS 17,200 B6.29 10.453.43 0 6,746.57 39.22 TOTAL CONTRACTUAL SERVICES 49,600 88.29 23,242.72 0 26,357.28 53.14 SUPPLIES 101-4220"-321 OTHER. SERVICES 600 .00 614.52 0 14.52- 2.42- 101-4220'0-339 MAINT F REPAIRS/EQUIP-MENT 4,000 75.00 1,785.79 0 2.214.21 55,36 TOTAL SUPPLIES 4,60C 75.00 2.400.31 0 2,199.69 47.82 CAPITAL EXPENSES 101-42200-453 MACHINERY F. EQUIPMENT 11850 .00 908.91 0 94L.09 50.87 TOTAL CAPITAL EXPENSES 11850 .00 908.91 0 941.,09 50.E7 TOTAL PUB NCRKS/ 'AIN/REP EQUIP 88,350 2,542.50 50.488.61 0 37,861.39 42.E5 Pt GE 28 -- - S T. A N T H 0 N Y R U D G E T R F. P 0 P T F O R F I S C A L Y E A R 1 9 8 7 NCVEMBER 3C. 1937 ACCOUNT NO. ACCOUNT NA4F BUDGETED CURRENT MONTH YEAR-Tr)-DATE ENCUMPEREC BALANCE % PE4-IT: aaaaaacacaacaataaaaaaaaoaaaaooaavaaaaaaoaaaavaoaaaaaavaaaasaaaaaasocaaaacaaaaaaaaaxaaaaaasaaoaaaaeaaaaaaoaaaaaoaaaoaa.oaoacr.00eca+o++ r GENERAL a EXPENSES a TREE E HEED CARE aeaaaaaa�aaavo•zaaoaaataaaaaaaaasaaaaaaa�a*aaa'aaaacaataaaaaasaaaaavaaaaaaaaaasaaeavaaazaaaaaaaaa:aaataaoaa*aaaaaaaaaaaaoaAaa4a.oaao:CII* PERSONAL SERVICES 101-43100-110 SALARIES REGULAR 11,500 493.60 9.781.50 0 1,718.50 14.94 101-43100-114 EMPL CONT/PENSION 1.350 .00 1.483.95 0 I33.95- 9.92- 101-43100-115 EMPL CUNT/INSURANCE 11050 173.2.0 999.20 0 50.80 4.P4 TOTAL PERSONAL SERVICES 13.900 666.80 12.264.65 0 1.635.35 11.77 CONTRACTUAL SERVICES - 10i-43100-220 OFFICE SUPPLIES 200 .00 265.90 0 65.50- 32.95- 101-43100-226 GENERAL SUPPLIES 300 .00 147.37 0 . 152.63 50.89 TOTAL CONTRACTUAL SERVICES 500 .00 413.27 0 86.73 17.35 SUPPLIES 101-43100-320 CONSULTING/CONTRACTUAL SERV 500 345.00 345.00 0 155.00 31.00 101-43100-339 MA114T f. P,EPAIRS/EOUIPMENT i,000 .00 414.63 0 585.37 58.F4 101-43100-348 BEAUTIFICATION/TREE PLANT 0 .00 .00 0 .00 .0e TOTAL SUPPLIES 1,500 345.00 759.63 0 740.37 49.36 TOTAL TREE L REED CARE 15.900 1.011.80 13,437.55 0 2,462.45 15.49 PAGE 1S - S Y. A N T H O N Y 8 11 C G E T R E P O R T F C R F I S C A L Y E A P. l 9 P, 7 NOVEMBER 3C, 1987 ACCOUNT NO. ACCOUNT NA"F RI)OGFTED CURRENT MONTH Y{AP-10-DATF ENCUMBFPED BALANCE 2 PE`4A!N aaaaaaaataaa*tatasto-ta.aeat*aaaa*asa*apse*aaat**a**tatatnaa*maaaaaaaaaa#sate*ctaaateataaattnaaa area*e��aaa**aascaaa*sa:a*Etaaaatrt*a�ata a GENERAL * EXPENSES a PARKS asoat:*astaaaaatatsataata*atrtet**a*aataeaea*aa*aaaa*aaaertateaaaaaaasaaaeasaa*aanauta*astat.arataaaacost*a«aasnr--as**ataaao+r*ncaa***aana PERSONAL- SERVICES 101-45530-110 SALARIES - REGULAR 23,000 1.405.34 16,175.51 0 6,624.49 29.67 101-45500-111 OVERTIME 500 .00 26.16 0 473.84 94.77 101-45500-114 EMPL CONTR/PFNSION 2,700 427.91 2.268.57 0 431.43 15.98 101-45500-115 EMPL CONTR/INSR 2.100 175.00 1,695.00 0 205.00 9.76 TOTAL PERSONAL SERVICES 28,300 2.008.25 20,365.24 0 7,934.76 28.04 CONTRACTUAL SERVICES 101-45500-223 SMALL TOOLS 250 .00 7.70 On 242.30 96.92 101-45500-226 GENERAL SUPPLIES 2.750 .00 1.581.08 0 1.168.92 42.51 TOTAL CONTRACTUAL SFRVICFS 3.000 .00 1.588.78 0 .411.22 1:7.04 SUPPLIES 101-45500-337 HAINT C REPARRS - OTHER 21500 .00 2.696.66 0 196.66- 7.87- 101-45500-338 RENTALS 100 32.15 32.15 0 67.85 67.85 i.^1-45500-339 MAINT C REPAIRS/EQUIPMENT 1,200 14.13 1,151.23 0 48.77 4.06 TOTAL SUPPLIES 3,800 46.28 3x880.04 0 60.04- 2.11- CAPITAL EXPENSES 101-45500-453 MACHINERY F. EQUIPMENT 4,000 1.774.61 4.!06.72 0 6.72- 17- 101-45500-459 OTHER IMPROVEMENTS 0 .00 .00 0 .00 .00 TOTAL CAPITAL. EXPENSES 4.000 1.774.61 4,006.72 0 6.72- .17- TOTAL PARK 39,1100 3.829.14 29.840.78 0 9,259.22 23.66 TOTAL G,E14ERAL FUND 1,764,525 107.809.08 1,480.168.57 0 304,356.43 17.06 BALANCE GENERAL FUND 0 88,381.15- 568,563.97- 0 56=,563.97- .00 t PAGE 35 S T. A N T H O N Y _ B U 0 G E T R E P O R T -- F O R F 1 5 C A L Y E A R 1 9 8 7 NOVEMBER 30. 1Q87 ACCOUNT N0. ACCOUNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATE ENCUMBERED BALANCE T, REMAIN ES SQbQQQQSSSQQSQSSQSQQQSSQQ#SS SStSOaQ#SQ SS#QSS:SQQSSSSQSII6QQQSQ6 QQQ#tS#SQQSQQSQSQS:QQ##QQQQSQQQ gSSSQQASSQQS4QQQSSQQQQSF�#OQaSSQQCS06 i Q HRA FUND # RF.VENUFS # aQatQQQQQQ#Q##QQ#QtQQQQQQQQQ##aQQQ#Q#QyaQ#QaQaQ#QQaQ,QQQ#sasQQQaxQaQQQQQQQQQasQQQa#saasQOaaQaaQQQQQaQQQQQ#nQQaaQQQQQQaasQ4Q�a#sxQQQQQ TRANSFERS 30 1-30110-000 REVENUE FROM OTHER AGENCIES 0 .00 .00 0 .00 .00 301-301.30-000 TRANSFER FROM GENERAL FUND 13.500 .00 52.457.72 0 38.957.72 288.58- TOTAL TRANSFERS 13.500 .00 52.457.72 0 38.957.72 288.58- MISCELLANEOUS REVENUE 301-38100-000 INTEREST-INVESTMENT EARNINGS 0 .00 .00 0 .00 .00 301-38400-000 ADMIN. REIMS-TAX INC. BD FD 0 .00 .00 0 .00 .00 TOTAL MISCELLANEOUS REVENUE 0 .00 .00 0 .00 .00 TOTAL HRA FUND 19.500 .00 52.457.72 0 38.957.72 238.58- - i - i - i r i PAGE 36 S T. A N T H O N Y 9 U 0 G E T R E P O R T F C R F I S C A L Y E A R 1 9 8 7 NOVEMBER 30, 1987 AC%OUNT NO. ACCOUNT NAME RUDGETf-0 CURRENT MONTH YEAR-TO-DATE ENCUMBERED BALANCE % REMAIN t!d#}0###idttg#II#gt##II#OIIIIC}II4#0####At##g:#II#:Ci CQg?i}##}#g#bIIIIIIRO#}}}II#d0####iii##IIIIC##t0#it00#OOPtOipi.}#OIIgtOOigQ}#}ii#}idIIdpii#ii # HRA FUND # EXPENSES # PERSONAL SERVICES #gpt#i�#tp#a#dttta#gi#a#IIttg#at##tta0i#aa3g#sa######dgdd#aaag##*##a}##ztaa}}ia#i#ta#e}g#II4ap#t##e#tidiaiaiasia###sga##i#}as}gi#go#at PERSONAL SERVICES 301-40LOO-110 SALARIES 81000 .00 .00 0 81000.00 100.00 301-40100-114 PENSION B00 .00 .00 0 600.00 100.00 301-40100-115 INSURANCE 360 .00 .00 0 360.00 100.00 TOTAL PFRSONAL SERVICES 9,160 .00 _00 0 9,160.00 100.00 SUPPLIES 301-40100-320 LEGAL FEES 3,000 3,742.18 31,02A.50 0 28,028.50- 934.28- 301-40100-341 TRAVEL CONFR L SCHOOLS 840 20.00 56.00 0 784.00 93.33 301-40100-342 SUBSCRIPTIONS 0 .00 100.00 0 100.00- _00 301-40100-349 MISCELLANEOUS EXPENSES 500 2.755.65 13,564.77 0 13,064.77- 612.95- TOTAL SUPPLIES 4,340 6,557.83 44,749.27 0 40,409.27- 931.09- CAPITAL EXPENSES 301-40100-491 BOND 6 INTEREST PAYMENT 0 .00 96,012.50 0 96,012.50- .00 TOTAL CAPITAL EXPENSE 0 .00 96,012.50 0 96,012.50- .00 SUPPLIES 301-40100-675 LAND ACOUISITTON 0 .00 .00 0 .00 .00 TOTAL SUPPLIES 0 .00 .00 0 .00 .00 TOTAL PERSONAL SERVICES 13,500 69557.83 140,761.77 0 1279261.77- 942.6B- TOTAL HRA FUND 13,500 6,557.83 140,761.77 0 127,261.77- 942.68- BALANCE HRA FUND 0 6,557.83- 88,304.05- 0 88,304.05- .00 PAGE 37 S T. A N T H O N Y R U O G F T R E P O R T F O R F I S C A L Y E A R 1 9 8 7 - NOVEMBER 30. 1987 ACCOUNT NO. ACCOUNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATE ENCUMBERED BALANCE S REMAIN IIa44 a444RII4t443Qt4Rd44t4 Q$IIdifi ad44II4d4fiII4444#$4$tbtQ#4$dIIt444Rt044QbII4d4$64$IItd4abtaQd.k C3ab Rttfi:l a44QQR$dQQQb#R#II$t34#444$4$$dQdb4$ba4 a CAPITAL EQUIPMENT FUND d REVENUES 4 IIR C4#sb44t$a#tt4t4#Otbb#4IIIIR4t4dR#444$14 RtR$O4btROt#II#44II4444t$44RbdII4tII#bIIIIt$44$St44fi II+k+l44tIIII$d4a4$fib$4$4$44#4$$4o$$t+O 444td4#fi ffilta TAXES-LEVIES ,401-3011C-000 REVENUE FROM OTHER AGENCIES 0 .00 .00 0 .00 .00 TOTAL TAXES 0 .00 .00 0 .00 .00 INTERGOVERNMENTAL REVENUE 401-32010-000 REVENUE FROM OTHER AGENCIES 0 .00 .00 0 .00 .00 TOTAL INTERGOVERNMENTAL REVENU 0 .00 .00 0 .00 .0C INTERGOVERNMENTAL REVENUE 401-367CO-000 TRANSFERS FROM GENERAL FUND 110.000 .00 .00 0 1101000.00- 100.^o TOTAL INTERGOVERNMENAL REVENUE 110.000 .00 .06 0 110.000.00- 100.0C MISCELLANEOUS REVENUE 401-38100-000 INTEREST EARNED 0 .00 .00 0 .00 .00 401-38400-000 CAPITOL EQUIP 0 3.074.94 126.376.02 0 126.376.02 .00 401-38670-000 TRANSFERS FROM GENERAL FUND 0 .00 .00 0 .00 .00 ` 401-39990-000 RESERVES 0 .00 .00 0 .00 .00 TOTAL MISCELLANEOUS REVENUE 0 3.074.94 126.376.02 0 126.376.02 .00 TOTAL CAPITAL EQUIPMENT FUND 110.000 3.074.94 126.376.02 0 16.376.02 14.89- .f L • • PAG• 38 J S T. A N T H O N Y B U O G F T R E P O R T F O R F I S C A L Y E A R 1 9 8 7 NOYE4BFR 30, 1987 ACCOUNT NO. ACCOUNT NAMF RUDGFTED CURRENT MONTH YFAR-TO-DATE F,NCUMBERFD BALANCE ° REMAIN aa######as###IIae#IIea####aObaaa#statt4ts#a##II2#II4#IIS#sJa#a###sROII aIIe►#t###a#s0##tab###abaat#saba t#b#t4a##d##s######a##0##a#aab#a#sa#b a CAPITAL EQUIPMENT FUND = EXPENSES t APPROPRIATIONS esaat#aaaa#a#dasatassaaa#s#a##ba#aabota#a##a###a##eIIe#aasas##aII#a#aaa#aaaeetasaosaaa#saga#aaasIISSasIIa#a#tar.##sa##asssa#a####IIaaaaaas SUPPLIES 401-47200-453 MACHINERY E EQUIPMENT 110.000 .00 105.168.00 0 4.832.00 4.39 TOTAL SUPPLIES 110.000 .00 105068.00 0 4.832.00 4.39 TOTAL APPROPRIATIONS 1101000 .00 105.168.00 0 4.832.00 4.39 TOTAL CAPITAL EQUIPMENT FUND 110.000 .00 105.168.00 0 4.832.00 4.39 BALANCE CAPITAL EQUIP FUND 0 3.074.94 21.208.02 0: 21.208.02 .00 PAGE 59 S T. A N T H O N Y 8 U 0 G F T R E P O R T F O R F I S C A 1. Y F A R 1 9 8 7 NCVEMBER 30, 1487 ACCOUNT NO. ACCOUNT NAME BUDGETED CURRENT MONTH YEAR-TO-DATE ENCUMBERED BALANCE % REMAIN aaatr.aaaasasasaastsasaaaaassaaasaasaaaaassaasaaaasaaaas.aaaaaar.aaaaaaaaassaaaaassasaaataasataaatatseaaaaasaoaatttaaaaacstaaastsassaaa s UTILITY FUND a REVENUE t auaaaaxaaataaaaaaaaaaaassaaatsataaaaasaaaataaaaaaeeassaa+osaaaaaaaaaassoosa.asaasasaasaaxaasxasxaaaatasssaasaaaaaaaaasaasasaasaaaaaasa MISCELLANEOUS REVENUE 701-38100-000 INTEREST.INVESTMENTS 0 .00 .00 0 .00 .00 701-38150-000 INTEREST INVFSTMENTS 0 .00 .00 0 .00 .00 701-38250-000 METER,TAPS.ETC. 200 125.70 125.78 0 74.22- 37.11 701-38300-000 PERMITS 100 35.00 195.00 0 95.00 95.00- 701-38350-000 PERMITS 500 125.00 980.00 0 480.00 96.00- 701-38400-000 MI-SC REFUNDS L REIMBR 100 .00 7.50 0 92.50- 92.50 701-38450-000 MISC REFUNDSE REIMBR TAPSFTC 50 .00 73.65 0 23.65 47.30- 701-38500-000 SERVICE CHARGES 479.800 44.40- 324.471.49 0 155,328.51- 32.37 701-38550-000 SERVICE CHARGES 260.000 708.00- 224,628.85 0 35_.371.15- 13.60 701-38560-000 WATER ON E OFF CHARGES 200 .00 45.00 0 155.00- 77.50 _ 701-3857-0-000 LATE PMT E READING 1.050 465.00 2.1AO.00 0 1,130.00 107.62- 701-38650-000 METER REPAIRS 0 .00 101.70 0 101.70 .00 701-38700-000 INTERESTFINVESTMENT EARNING 13,000 .00 .00 0 13,000.00- 100.00 701-38910-000 MISC RECEIPTS 0 .00 2.779.99 0 2.779.99 .00 701-38990-000 RESERVES 0 .00 .00 0 .00 .0C 701-38991-000 RESERVES 0 .00 .00 0 .00 .00 C TOTAL MISCELLANEOUS REVENUE 755,000 1.-62- 555.588.96 0 199.411.04- 26.41 TOTAL UTILITY FUND 755,000 1.62- 555,588.96 0 195,411.04- 26.41 r' f .i •-- PA� 60 S T. A N T H O N Y 8 U 0 G F T R E P O R T F D R F I S C A L V F A R 1 9 8 7 NOVFMRFP 30. 1987 ACCOUNT NO. ACCOUNT NAPE BUDGETED CUPaFNT M!1NTH YEAR-TO-DATE ENCUMRERED BALANCE 8 REMAIN asaaaaaaaaaaaaasaaaa.aasaaaaaaaasaaaaaaaaaaaaaasaaaasaaaaaaaaaaaaar- :aaa:asaaaaaaaaa_sraaaaaaaaaaaeaaaaaaaaaaaaaaaaaseaaaaaaaaaaaaaaaas a UTILITY FUND EXPENSES a aetasataaaaaaaaaaaaaaasaar.aaaaaaasaaasaaaaaaossaaaaaaaaacaaaacaasaaaaaasaaaaaaaaaaaaaaassacaaaaaaaasaaaasaaaaaaaaaaaa saaaaaaaaaaaaas PERSONAL SERVICES 701-48100-110 SALARIES-REGULAR 57,100 4,526.76 55,049.49 0 2,050.51 359 701-48100-111 OVERTIME 1,000 41.-52 344.76 0 655.24 65..52 701-48100-114 EMPL CONTR/PENSIONS 6.700 174.86 6,707.87 0 7.87- .12- 701-48100-115 EMPL CONTR/INSURANCE 4,500 390.00 3,770.10 0 729.90 . 16.22 TOTAL PERSONAL SERVICES 69.300 5,140.14 65.872.22 0 3,427.78 4.95 CONTRACTUAL SERVICES 701-48100-220 OFFICE SUPPLIES 1,400 200..00 1,317.79 0 82.21 5.87 701-48100-222 MOTOR FUEL L LURR. 2.550 .00 .00 0 2,550.00 100.00 701-48100-223 SMALL TOOLS 50 .00 .00 0 50.00 100.00 701-48100-226 GENERAL SUPPLIES 2.700 52.99 379.02 0 2.320.98 85.96 TOTAL CONTRACTUAL SERVICES 6.700 252.99 1,696.81 0 5.003.19 74.67 SUPPLIES 701-48100-320 CONSULTING/CONTR. 3,050 240.43 5,751.75 0 2,701.75- 88.58- 701-48100-321 OTHER SERVICES 600 13.00 227.50 0 372.50 62.08 701-48100-331 COMMUNICATIONS 300 .00 160.34 0 139.66 46.55 701-48100-335 INSURANCE 16,200 .00 11.334.00 0 4,866.00 30.04 701-48100-336 UTILITIES 4,400 244.78 4.680.26 0 2,30.26- 6.37- 701-48100-339 MAINT C REPAIRS/EOUIPM. 7,300 491.79 6.769.08 0 530.92 7.27 701-48100-341 TRAVEL, CONFR. L SCHOOLS 150 .00 50.95 0 99.05 66.03 701-40100-343 M N C C CHARGES 358.000 24,896.08 248.960.80 0 109.039.20 30.46 TOTAL SUPPLIES 390.000 25.886.08 277,934.68 0 112.065.32 28.73 CAPITAL EXPENSES 701-48100-453 MACHINERY E EQUIPMENT 0 .00 .00 0 .00 .00 701-48100-481 DEPRECIATION 0 .00 .00 0 .00 .00 TOTAL CAPITAL EXPENSES 0 .00 .00 0 .00 '.00 TOTAL 466.000 31,279.21 345v503.71 0 120,496.29 25.86 PAGE 61 S T. A N T H O N Y - . B U D G F T R E P O R T F O R F I S C A -L Y E A R 1 9 8 7 NOVFWBFR 30. 1987 ACCOUNT NO. ACCOUNT NAME BUDGETED C1)RRF.NT MONTH YFAP-TO-DATF FNCUM8FRED BAI.ANCF. $ RFNAlN r-etas*seataapso#aaotaaaataaaaaaaapcosapeasatooa#eaaaa#eapaeo#atat##aeoat#aasstaepaaaaataaa#a#ta#atsaaoaoaaaaa##aaa###a#oa+ aaao#oassa a UTILITY FUND EXPENSES a WATFR asoaaaaaaosooaoaaoaaoaasaaaa#a#toaaatoaao#ota#s#aaca.s#aooaaaastaasasasoaoatooaota00000aasasoaaasaa#ocessaoaoaoaaaasssotaoaoaoaaoasoa PERSONAL SERVICES 701-48200-110 SALARIES- REGULAR 96.170 8,065.08 88.569.97 0 7.600.03 7.90 701-48200-111 OVERTIME 9.000 311.49 7.808.25 0 1,191.75 13.24 701-4820D-114 EMPL CONTR/PENSIONS 12:130 894.20 11.262.00 0 868.00 7.16 701-48200-115 EMPL CONTR/INSURANCE 8.000 598.80 51835.88 0 2,164.12 27.0' TOTAL PERSONAL SERVICES 125,300 9.869.57 113.476.10 0 11,823.90 9.44 - CONTRACTUAL SERVICES 701-48200-220 OFFICE SUPPLIES 2.700 7.68 1.925.47 0 . 774.53 28.69 701-482OC-222 MOTOR FUEL E LUBR. 4.950 .00 495.51 0 4,454.49 89.99 701-40200-223 SMALL TOOLS 350 .00 217.53 0 132.47 37.85 701-48200-226 GENERAL SUPPLIES 6.000 63.75 3.693.30 0 2.106.70 35.11 TOTAL CONTRACTUAL SERVICFS 14,000 71.43 6,531.81 0 77468.19 53.34 SUPPLIES 701-48200-320 CONSULTING/CONTR. 8.890 2.216.40 27,427.46 0 18,537.46- 208.52- 701-48200-321 OTHER SERVICES 1.500 39.00 797.45 0 702.55 46.84 701-48200-331 COMMUNICATIONS 11600 103.96 969.77 0 630.23 39.39 701-48200-334 PRINTING E PUBLISHING 300 .00 157.79 0 142.21 47.40 701-48200-335 INSURANCE 16.000 .00 13.609.95 0 29390.05 14.94 701-48200-336 UTILITIES 46.200 2.82.5.90 43,627.67 0 2,572.33 5.57 701-48200-337 MAINT L REPAIRS/OTHER 3.250 130.00 422.04 0 2.827.96 87.01 701-48200-338 RENTALS 0 .00 29.00 0 29.00- .00 701-48200-339 MAINT L REPAIRS/EQUIPM. 27.700 648.08 29.840.61 0 29148.61- 7.76- 701-48200-340 MAINT E REPAIRS/BUILDING 1,500 .00 300.72 0 1,199.28 79.95 701-.48200-341 TRAVEL, CONFR. E SCHOOLS 500 .00 331.70 0 168.30 33.66 701-48200-342 SUBSCRIPTIONS E MEMBERSHIPS 60 .00 35.00 0 25.00 41.67 TOTAL SUPPLIES 1C7.500 5.963.34 117.557.16 0 10.057.16- 9.36- CAPITAL EXPENSES 701-48200-453 MACHINERY L EQUIPMENT 4,800 .00 1.450.34 0 3,349.66 69.78 701-48200-454 METERS C FIXTURES 61000 .00 306.67 0 5.693.33 94.89 701-48200-460 CARBON FILTRATION PLANT,FFES 0 .00 .00 0 .00 .00 741-48200-482 LOSS ON DISPOSAL 0 .00 .00 0 .00 .00 TOTAL CAPITAL EXPENSES 10.900 .00 1,757.01 0 9,042.99 83.73 TOTAL 257.6CO 15.904.34 239.322.08 0 18.277.92 7.10 TOTAL UTILITY FUND 723.600 47.183.55 584.825.79 0 138,774.21 19.1P BALANCE UTILITY FUND 31,40C 47.185.17- 29.236.83- 0 60.636.83- 193.11 ST. ANT;IONY FIRE DF.PARTI1LiJT M011THLY REPORT COMPArr RU: L. OLCI A TIl O�l l LOSS REMARKS AT FIRES,T C,ErnR P Et C2I.A�L q.C OHPA_h: : f ':O. FIRES AID DUTY INSPT HRS MIN HRS HIN HRS iMIN HRS MI 03 '0 3-02 L VE 7r3 Z- Zo n,?7-c,- Pj Us S TV No r /71 O �' 7 row S FS�L.v _ - /O vii d c,lT`c i+Au.- ,'-Aifff5 (�/ `lzr,,;a�;� - ci�FciL \ ti X11. IZ-b Istib 3y�Z D . rn lao - - 2-� 11uD G-G l l�ravi-- �'APr�wc � 3 0 Z�s 12-$ 1�s3 `RpPckv- PLAZA l-e( t r6e- L�5w -5TH frA5 Seizv,n,65 33 0 7Z(o APAcAc PLAZA - W/kLR3�F C�W�S CHAS 00-br— 2i7 7 cl Nio Dos--B 3860 AL TF - ou Cie,b03 6 -F IZ-10 11,10 SikDpj - G ► fxu- W-Tii�S E�D 12-ID 15610 6 5fis�-. RurIes i iz- 00 ;Ll Z?Z( Fc��, pz. Lpgc -cNf SIG "L 12-) l 679-7 3216 bet-lr,4 f�p— --- mc�tc�� - P>P(e-K- INJGt� Z�I 8o 3 2- 11 /0()S ST. ANTHONY FIRE DFPART11ENI' MONTHLY REPORT COMPANYJE�,;b. r;21 7-K,4.// //C; 7 RUrl DATE TI►1r LOCATION LOSS REMARKS AT FIRST SPECIAL COMPAN 1:0. FIRES AID DUTY INSPT HRS MIN HRS MIN HRS MIN HRS 01 1?-11 cz iloec-4 Z's-//op )c4-r"(S-o;�) Y91 C- v BG 1 /o 8 o as os.s l - P . o Z z SO 13-51 35Li1 5(. N-6• Fut Zlp 812 ►z-zl m(--sD (pc(�A P(./f. SLt(-p�i�3 S1 112-?-2- (CN IfI00 as AA-LIc/Cr �iG �a-a oS 370 5.5 RD a-7 b -3 ya Foss pq �'l 9 /ys ycoL, >C - I a3 1 N�( 3�a 1 ('��o '>r D2. Roz mcn,c _ FL-o 3y G ST. ANTHONY FIRE DF..PIIRTI131JT M014TIlLY R);PORT COMPANY (-NG i j �Z , 1 -7-eyUL 11 RUN' DPTE TI!ir: LOCATIO14 LOSS REMARKS AT FIRST SPECIAL COMPAN FIRES AID DUTY INSPT ���� HRS IMIN HRS IHIPJ. HRS IMIN HRS MI l l:� :2 y 0100 50vTu Si n c or- Alec-NC y„��� - 4 L--p� y�o Q V 07sS SSU AJ,, 88 CW �a-a(- 1,2 -s _ � --2 gz-1 1�-i1 5�0,� a—D itwy 6"kusc ALA -A 6Z8 N-z-'&g lo,> CA C.ciu 9'91 '�wM 09 ge,6 A LLD MEMORANDUM • DATE: January 6 , 1988 TO: David Childs , City Manager Department Heads FROM: Connie Kroeplin ITEM: STAFF MEETING NOTES - JANUARY 5 , 1988 DEPARTMENT PRIORITIES/GOALS FOR 1988 Larry Hamer - Public Works +1 . Temporary carbon filtration system *2 . Reconstruction of watermain -adjacent to Stonehouse/St . An- thony Shopping Center +3 . Tennis courts - lights - timers *4 . Resurface tennis courts ( 2nd half 'of 2 year project ) *5 . Seaicoat from 27th to 31st - west of Silver Lake Road • 46 . Reconstruction of St. Anthony Boulevard- south of BNRR Bridge +7 . Concrete street repairs *33rd ( adjacent to high school) *Edward (at 36th) *Chelmsford and Penrod at 37th 8 . Comprehensive road replacement program (pending outcome of community survey) 9 . Foss Road lift station reconstruction 10 . Replace/repair holding pond spillway 11 . Silt removal from holding pond 12 . Response to sanitary and storm sewer cost studies *13 . Crackfill concrete streets 14 . Update the equipment replacement plan 15 . Concerns about fire station relocation (pending completion • of negotiations with school ) +16. Recycling #17 . Carbon filtration plant construction. The group discussed these priorities/goals and felt that ( 1 ) some items ( shown with * ) are maintenance/budgeted items and would not be on list of top 5 or 6 goals ; ( 2 ) some items are approved and underway, so coordination is needed and are not shown as top goals ( shown with # ) ; ( 3 ) some items need guidance from decision makers , re: funding/timing ( shown with + ) ; and ( 4 ) the remaining items are identified as follows and in the following priorities as the Public Works top goals for 1988 : 1 . Foss Road Lift Station reconstruction. 2 . Storm/sanitary sewer system study implementation. . 3 . Spillway repair/silt removal - holding pond. 4 . Equipment replacement program. Carol Johnson - Finance Department 1 . Draft ordinance and report relating to water and sewer rate increases as projected in 1988 budget (consider flat rate for sewer) by March 15 , 1988 . 2 . Compiete training of new Senior Accounting clerk. 3 . Planning/decision making recommendations relating to water/ sewer billing and payroll data processing systems . 4 . New voting machines - community information and training and judges training. 5 . Hiring of receptionist and administrative assistant by July 1 , 1988 . Don Hickerson - Police Department 1 . Resolve computer situation. City is leasing the current terminal on a temporary basis to allow connection with State Police data system but needs to make permanent plans which could include providing some in-house cap- ability for the Police Department. The Chief is in- vestigating/studying this. 2 . Get help for the Investigator - either through (a) addi- tional staff ; or (b) reallocation of current manpower. 3 . Get/keep Police Reserve program going and effective. 4 . Organize remainder of City in Neighborhood Crime watch ( using Reserves to assist ) . Ray Nelson 1 . Apache Wells Saloon a . *are on month to month lease b. *poor visibility/location C . *mechanical/electrical/plumbing systems are obsolete Look at options , including *C. G. Rein proposal to_ construct new :building--whe-r-e- Health Club was *expand into old off-sale space ( low priority due to a, b,. c , above) *remodel N.A.P.A. (old Wards Auto Center space) *others? 2 . Computer • Small computer to maintain price and inventory records but would not be an computerized. inventory control system ini- tially. 3 . Stonehouse Refurbish patio, new furniture , with eye to further expan- sion or new enclosed addition to be constructed, if success- ful . 4 . Consider converting old Speakeasy space into business lunch area (Rotary; Kiwanis , etc . ) or area for catered groups , etc. (Existing booths to be reused in Apache Wells relocation/expansion. ) 5 . Update procedures manual and training program for employees . 6 . Monitor dram shop insurance rates in light of new under- writers and, the fact that food is being served at Stone- house. Dave Childs *TCAAP litigation resolution. *Kenzie Terrace Redevelopment completion. -4- • *Comparable Worth - study completion and implementation recom- mendations. *Parkview negotiations%facility study.. *Survey results - goal setting. Follow up on: *carbon plant *water%sewer problems *computerization *administrative assistant *Apache Wells Administrative Assistant Newsletter CDBG Cable TV Budget Recycling Personnel/Comparable Worth Elections Zoning Insurance r • NOTICE OF HEARING ON IMPROVEMENT TO WHOM IT MAY CONCERN: Notice is hereby given that the City Council of the City of St. Anthony will meet in the Council Chambers of the City Hall at 8 : 00 P.M. on the 12th day of January, 1988 , to consider the making of an improvement on St. Anthony Boulev- ard between the Burlington Northern Bridge and the southern City limits line to reconstruct the existing roadway with a new bituminous roadway with new curb and gutter and replacing existing catch basins and leads , pursuant to Minnesota Statutes , Section 429 . 011 to 429 . 111 . The area proposed to be assessed for such improvement is the property abutting on such street. The estimated cost of such improvement is $440 , 000 . 00 . Such persons as desire to be heard with reference to the proposed improvement will be heard at this meeting.. David M. Childs City Manager Publish: December 30 , 1987 and January 6 , 1988 • ' ,%4 ESOT ,/1 �oe� 4yo Minnesota ; Department of Transportation a Transportation Building �v St. Paul, Minnesota 55155 tiT OF office of) � (612) 296-3000 Apri rc) u�p'1 Steve Campbell St. Anthony City Engineer' ;', '. % Short -Elliott-Hendrickson 222 Little Canada Road << St. Paul , MN 55117 �+ �"� In reply refer to: Request for Variance Dear Mr. Campbell : Upon the advice of a variance Committee appointed expressly for the purpose of recommending to me, the validity of the City of St. Anthony' s . request for -a variance from the Minnesota Rule 8820.9912 so as to permit a 32' wide street with no parking instead of' the required width of 36' with no parking, I hereby grant the variance. The variance is conditional upon receipt of a resolution by the City Council . of the St. Anthony that indemnifies , saves and holds harmless the State of Minnesota and all its agents and employees of and from any and all claims , demands , actions or causes of actions of any nature or character arising out of or by reason of, in any manner, the reconstruction of St. Anthony Parkway (MSAS 106) from a point south of the Burlington Northern Railroad track to Ridgeway Drive in any other manner than as a 36' wide street with no parking in accordance with Minnesota Rule 8820.9912 and further agrees to defend at their sole cost and expense any action or or proceeding commenced for the purpose of asserting any claim of whatsoever character arising as a result of the granting of this variance. Sincere L 0NARD W. LEVINE Commissioner An Equal Opportunity Employer 'r r CITY OF ST. ANTHONY PUBLIC IMPROVEMENTS ASSESSMENT POLICY February, 1986 In order to insure that costs of public improvements such as streets, curb and gutter, and sewers - are charged in the most fair and equitable manner, the City Council of the City of St. Anthony has determined the following to be the Assessment Policy for the City. i Section 2.1 . Curb; Gutter The cost of construction of curb and gutter will be charged in total on a per foot basis against the abutting property owner. Section 2.2. . Streets All streets shall be assessed to abutting property owners on the following basis : Residential Streets a. Eight (8)_ foot width on the basis of the cost of a five (5) ton • per axle capacity bituminous street, assessed directly to abutting property owner and anything over the eight (8) foot width or the five (5). ton per axle capacity bituminous basis will be paid by the City of St. Anthony. b. The general method of assessment will be on a per front foot basis . In order to assure that costs are equitably assessed, however, it may be necessary for the City Council to assess on- a per lot or square footage basis when special circumstances require it, i .e. , odd shaped lots on cul -de-sac or winding streets . c. The cost of street intersections and those portions of the street which abut alley right-of-way will be paid by the City of St. Anthony. Corner Lots On residential properties, the cost of street pavement will be paid by the property owner on the long side of said corner lot. The shorter side will be paid for by the City of St. Anthony. Non- residential corner lots will pay for both sides. " Section 2.3. Sanitary Sewer Costs for sanitary sewer will be paid out of the sanitary sewer fund. Section 2.4 Watermains Costs for watermains will be paid for out of the water fund. Page 2 Section 2.5 Alleys • The cost of construction or reconstruction of alleys- shall be assessed to the abutting : property owner on a per foot basis . Section 2.6 Storm Sewers - Costs for storm sewers will be assessed to the property owner on a square footage basis within the drainage area as established by the City Engineer. Section 2.7 General a. The assumed life expectancy of curb and gutter, and street surface shall be for a period of 20 years . The City shall be responsible for general repair and maintenance, which is not a result of negligence of the property owner, during that time, but overlays of bituminous materials periodically required shall be assessed using this policy. b. The above policy statements supersede all previous assessment policy and will be in effect upon adoption by the Council and all storm and sanitary sewers, curb and gutter, and streets will be deemed to be new construction commencing upon the date they were originally installed. c. In all new additions, all improvements shall conform with pro- • visions of Section 330 of the City Code and all costs shall be borne by the developer. d. Thi.s is a policy guideline only and shall not constitute by reason of public knowledge or otherwise a contract or agreement binding upon the City of St. Anthony. e. The City within the extent permitted by law shall have full power to modify, change or abrogate any part or portion of these policy standards. f. It is the policy of the City that assessments shall be based on the special benefits to the properties assessed. Costs of public improvements will be assessed according to the provisions of this assessment policy only to the extent that the assessment on any property does not exceed the special benefit to that property. PRELIMINARY DESIGN REPORT ST. ANTHONY BLVD. ST. ANTHONY, MINNESOTA ` '', r' r January 20, 1987 •'i r .. �c City Council City of St. Anthony 3301 Silver Lake Road St. Anthony, MN 55418 Attn: Mr. David Childs, City Manager �ET Mr. Larry Hamer, Director of Public Works Dear Council Members: rieke .carroll Submitted herewith is our study and report for the improvement of St. ^ iller Anthony Boulevard from the BN Railroad to Ridgeway Street. )ciates,inc. ,niteets The report presents the proposed design, funding considerations, construction engineers g � g land surveyors requirements, an estimated project schedule, conclusions and recommendations. We appreciate the opportunity to provide this information for you and look forward to discussing the report with you at your convenience. Sincerely, Robert C. Robertson, P.E. RIEKE CARROLL MULLER ASSOCIATES, INC. RCR:jj Enclosure 1011 first street south post office box 130 hopkins, minnesota 55343 612-935-6901 INDEX • PaR e INTRODUCTION I FUNDING 2 DESIGN q CONSTRUCTION REQUIREMENTS 7 PROJECT SCHEDULE g SUIVIMARY AND RECOMMENDATIONS 9 APPENDIX Soil Boring Logs s • PRELIMINARY DESIGN REPORT ST. ANTHONY BLVD. • RCM PROJECT NO. 861019 INTRODUCTION This preliminary report has been prepared and is submitted in accordance with our Agreement with the City of St. Anthony dated August 22, 1986. The project consists of approximately 2800 feet of Municipal State Aid (MSA) street construction on St. Anthony Blvd. from a .point 560 feet north of Ridgeway Drive to a point 560 feet south of the Burlington Northern Railroad tracks. The Gross golf course, owned by the City of Minneapolis, abuts St. Anthony Boulevard on the east and the cemetery abuts the roadway on the west. No other property owners abut the proposed improvements. The existing roadway is 32 ft-0" wide from face to face of the existing curb. The existing road section consists of about 2" of bituminous overlaying about 6" of concrete. • The subgrade material consists of lean moist clay. The road surface is rough and curb height is reduced due to bituminous overlays for maintenance. Surface drainage is collected at the low points along the roadway and drains westerly in storm sewers through the cemetery. Existing catchbasins on each side of the roadway allow the water to enter the storm water system at each of the low points. • -1- FUNDING • The funding for the project on St. Anthony Blvd. is to come from Municipal State Funds received from the State on an annual basis. The St. Anthony account balance after 1986 MSA construction will be about $180,000. The city fts 1986 construction allotment was $119,468. It is expected that the 1987 allotments will be approximately 12% less than in 1986 or about $105,000 for St. Anthony. The amount in St. Anthony fts account after receiving their 1987 allotment will be about $285,000. With an estimated project cost of $460,000, and additional $170,000 will be needed to finance the project. The city may use advance financing procedures allowed by the MSA rules, to provide the balance of the funds needed to accomplish the St. Anthony Blvd._ project. Three possibilities exist within the rules as follows: • 1. Advance encumbrance. The City can, by resolution, request an advance not- to-exceed 40% of its last State Aid apportionment. This would limit the City to about $42,000 of advance encumbrance. 2. The City can sell State Aid bonds with the amount and on terms such that the average annual principal and interest due in all subsequent calendar years on the bonds (including any similar obligations outstanding) shall not exceed fifty percent (50%) of the last annual construction allotment preceding the bond issue. Assuming that the City has no outstanding MSA bonds, approximately $60,000 of MSA bonds could be sold. 3. The City may also issue general obligation bonds to mature in not more than five • (5) years from the date of issue. The principal amount, including any prior issue, -2- may not exceed the total 'amount of the last construction allotment preceding the bond issue in any calendar year. • It would appear that the third method, using general obligation bonds, would be the only method listed above that would provide the amount needed for the St. Anthony Blvd. project. However, if some local funds were available on a temporary basis, one of the other methods could be used. • -3- DESIGN The proposed design for the project will include aft roadway from face-to-face of curb to meet MSA standards. No parking will be allowed for the minimum State Aid street width. Design speed for the roadway will be 30 miles per hour. The grade of the roadway will remain basically the same as it is due to the need to provide drainage from adjacent properties, match existing driveways, and sidewalks. The design of the pavement structure is as shown on the drawing on the following page depicting the typical section. A 5" bituminous base and surfacing section overlays a 12" gravel base and 14" sub-base to complete the 9 ton pavement structure. A separation between the bottom of the sub-base and clay subgrade is provided through the use geotextile material to inhibit penetration of the sub-base material into the relatively soft clay materials that underlie. the roadway. Contractors may have to provide some streatment of the clay subgrade to allow heavy construction equipment to operate without major disturbance of the subgrade. We understand the current right-of-way on the golf course side of the project is 2" behind the back face of the existing curb. The original right-of-way for St. Anthony Blvd. in this area is 100 ft; however, .subsequent negotiations with the Park Board/golf course apparently have limited the right-of-way to 2" behind the curb. To allow construction of the project a minimum of 5 ft of permanent easement should be obtained and a construction easement to allow workers access during the project of 10 ft in addition to the permanent easement, would be desirable. There are some elm trees between the curb and sidewalk (on the golf course side of the project) that are relatively close to the construction limits of the project. i.e. roots of the trees would be cut at approximately one foot from the face of the tree trunk. This • -4- Il could cause the tree to die and MSA will pay for removal and replacement of trees that are too close to construction. MSA will not pay for placing of new trees for landscape • a purposes only. We have included removal and replacement of trees in our construction estimate. If the trees are to be removed and replaced, it will be necessary to obtain permission from the Minneapolis Park Board. Drainage improvements will consist of replacing catch basins and storm sewer pipes within the construction limits of the project. The storm sewers that carry the drainage through the cemetery will not be included in the project. Therefore, the overall capacity of the drainage system will remain the same. Any ponding in the street that had existed in the past will continue to happen. We understand that -ponding has not been a significant problem in the past. Perforated pipe subdrainage will be provided in the low areas to allow water that enters the gravel base and subbase to dsain into the storm sewer system. The existing curb and gutter at each end of the project is B624 design. We propose to use a B618 design and taper the gutter sections to fit. This should save about $2,800 in construction cost. • -5- { � R R D 100 RIGHT OF WAY Z n O -0 32,' ( F-F ) F) Z D CEMETARY v �' `; GOLF Fxisj�c%� !Z COURSE o 0.5' CROWN i I n1� sFG-n o~I xlsTl e Mn./DOT 2331 MOD. WEAR 'Zo61r NOTE 0 11/2' Mn./DOT 2331 BINDER _ -n I. ALL BOULEVARDS SHALL Z 2" Mn./DOT 2331 BASE � HAVE 4" TOPSOIL , A 24" Z M 12" Mn./DOT. CL. 5 STRIP OF SOD NEXT TO CURB MINIMUM, SOD ALL O D 14p Mn./DOT. CL. 3 OTHER DISTURBED AREAS. I � D Z —1 GEOTEXTILE 2. B6-I8 CONCRETE CURB a 2 0 GUTTER Z CONSTRUCTION REQUIREMENTS • During construction the Contractor will be required to provide access to the cemetery and golf course from one direction only. This will allow the Contractor to work on approximately half of the job without interruption until the time of making the connection at the accesses to the cemetery and golf course. Further, it will be specified that the Contractor shall not excavate and leave open an unfilled excavation and shall provide positive drainage to storm sewers at the low points of the project at all times. Contractors will be required to construct the new pavement section on a stable subgrade. This may require a special preparation of the subgrade to carry construction traffic as indicated in the soils report appended to this study. • -7- PROJECT SCHEDULE The following schedule is based on the assumption that the City of St. Anthony proceeds with the project by authorizing design engineering services by the first of March, 1987. The estimated project schedule is as follows: Authorization of Engineering Design - March 1, 1987. Submit final plans to City - May 1, 1987 Submit final plans to MSA office - June 1, 1987 Advertise for Bids - June 15, 1987 Receive Bids - July 15, 1987 • Began Construction - August 1, 1987 Complete Construction - September 30, 1987 • -8- SUMMARY AND RECOMMENDATIONS The study and report that proceeded these recommendations provides detailed information on design and construction parameters for the St. Anthony Blvd. project. The roadway is to be constructed in a physically limited area with regard to the width of the roadway. The MSA minimum street width of 36 feet from face-to-face curb has been revised to 32 feet by variance and is recommended using a 30 mile per hour design speed and 9 ton axle load design for the project. A 31 inch pavement structure is recommended consisting of 5 inches of asphalt surfacing and base, 12 inches Class 5 base and 14 inches of Class 3 subbase material. Pavement structure is to be separated from the moist clay subgrade by geotextile construction fabric. Subdrainage will be provided at the lower areas to drain the granular part of the pavement structure to the existing storm water systems. • The estimated cost of the project is $427,000 to be funded using MSA dollars. No assessments are planned for the project. Some form of advanced funding, as outlined in the funding section of this report, will be required due to the lack of sufficient funds for the project in the City's MSA account. Street lighting cross conduits will be placed in the street to allow street lighting in the future, if desired. The estimated cost of street lighting is $35,000 to $80,000 depending on the type of fixtures selected. Based on discussion with your City Manager and Public Works Director, we did not include street lighting in the project as MSA funding is not available. -9- ST. ANTHONY BOULEVARD CONSTRUCTION COST ESTIMATE REV. 4/28/87 UNIT ITEM DESCRIPTION QUANTITY UNIT PRICE TOTAL 1 Mobilization 1 LS $10,000.00 2 Remove Curb 5,600 LF 3.00 1,800.00 3 Remove Concrete w/ 2" Bituminous Overlay 10,000 SY 5.75 57,500.00 4 Remove Catch Basins 4 EA 200.00 800.00 5 Remove Storm Sewer 75 LF 2.50 187.50 6 Unclassified Excavation 8,000 CY 2.25 18,000.00 7 Geotextile Fabric 16,800 SY 2.00 33,600.00 8 Aggregate Base Class 3 9,400 TON 5.50 51,700.00 9 Aggregate Base Class 5 7,620 TON 7.25 55,24.5.00 10 2331 Bituminous Base 1,010 TON 12.50 12,625.00 11 2331 Bituminous Binder 750 TON 12.50 9,375.00 12 2341 Bituminous Wear 750 TON 14.50 10,875.00 13 Bituminous Material for Mix 138 TON 150.00 20,700.00 . • 14 Tack Coat 875 GAL 1.50 1,312.50 15 B618 Concrete Curb & Gutter 5,600 LF 5.00 28,000.00 16 Concrete Driveway Pavement 300 SY 20.00 6,000.00 17 Construct Batch Basins 4 EA 1,000.00 4,000.00 18 12" RCP CL IV 75 LF 20.00 1,500.00 19 6" Drain Tile 770 . LF 10.00 7,700.00 20 Topsoil & Seed 2,000 SY 1.75 3,500.00 21 Pavement Marking 1 LS 600.00 600.00 22 Lighting Cross Conduit 400 LF 4.00 1,600.00 23 Remove & Replace Signs 1 LS 1,000.00 1,000.00 24 Erosion Control 1 LS 1,000.00 1,000.00 25 Temporary Construction Signs 1 LS 2,000.00 2,000.00 26 Field Office 1 LS 2,500.00 2,500.00 27 Saw Existing Pavement 170 LF 4.00 680.00 Subtotal $358,800.00 Contingencies 12,200.00 ESTIMATED CONSTRUCTION COST $371,000.00 ENGR.-LEGAL-ADMIN. 56,000.00 ESTIMATED PROJECT COST $427,000.00 Mn/DOT TP•301 12.02 18/80) STATE OF MINNESOTA DEPARTMENT OF TRANSPORTATION SAINT PAUL, MINNESOTA 55155 City (Village) of Date Clerk Engineer Address Status of Municipal State Aid Accounts As of 2 - Maintenance Construction Unexpended Balance $ '- $ 1 y�� Allotment • Total . Z�IS. a►J Allotment Transfers Disbursements 2 d —� - Unexpended Balance _—�7, rjO� 9"?4/Gh Less: Encumbrances Balance Available $ ALLOTMENT ENCUMBRANCES 00 -00 Project No. Amount SAP /6/-/U6-d J/ 12,5-276.L f VAIl,ASL-C- SP /G/- od0-06 .G G FPQM CulzhWt - 54 p /G/-Ooz4 D G DEPARTMENT OF TRANSPORTATION Sla AidKccb6nvant ACcountinp and Finance Section RESOLUTION 88-007 A RESOLUTION ORDERING IMPROVEMENT AND PREPARATION OF PLANS WHEREAS, a resolution of the City Council , adopted the 8th day of December, 1987 , fixed a date for a Council hearing on the proposed improvement of St. Anthony Boulevard between the Burlington Northern Railroad Bridge and the southern City limits line by reconstructing the existing roadway with a new bituminous roadway with new curb and gutter and replacing existing catch basins and leads, pursuant to Minnesota Statutes, .Section 429 . 011 to 429 . 111 ; and WHEREAS; ten days ' mailed notice and two weeks ' , published notice of the hearing was given, and the hearing was held thereon on the 12th day of January, 1988 , at which all persons desiring to be heard were given an opportunity to be heard thereon, NOW, THEREFORE, BE IT RESOLVED BY THE COUNCIL OF THE CITY OF ST. ANTHONY, MINNESOTA: • 1 . Such improvement is hereby ordered as proposed in the Council resolution adopted on the 8th day of December , 1987 . � . Rieke - Carroll Muller , Associates- is hereby designated as the engineer for this improvement. They shall prepare plans and specifications for the making of such improvement. Adopted this day of _ 1988 : Mayor ATTEST: City Clerk Reviewed for administration: City Manager • 1 \ O l qtr oMl I Ia,o � APPROVAL December 30, 1987 L Mayor and Councilmembers ]-, ]ROM Larry Hamer, Public Works Director -� PAINT STRIPER We have received two quotations for a hand paint striping machine: Prism-o, Model 160 w/kamber Model 38-1, with freight $2,656.00 Carrier Gable, Inc. with freight $3,338.48 Recommend we accept the lowest quotation from Prismo for $2,656.00. ESIVAWTED $U T vVPt� � ZS��_ - �o,�f�r�n /4P�ROVA-�- AM C :cjk1.12.88 0 �;:. � ■.7. . ne• PRICE Prismo Safety Corporation 400 Lanidex Plaza QUOTATION Parsippany,NJ 07054 •(201)884-0300 5412 QUOTATION NO. Please refer to this number when submitting an order. QUOTATION To: Village of St . Anthony DATE: December 9, 1987 3301 Silver Lake Rd. CONFIRMING Minniapolis , MN 55418 PHONE QUOTE: YOUR INQUIRY: Model 160 Paint Stripei FOR SHIPMENT F.O.B.: Mont mPryy PA To: FREIGHT: ❑Prepaid ❑Prepaid and add ❑Collect ❑Customer pick-up We appreciate the opportunity to submit the following quotation: Description Quantity Unit of Unit Total Quantity Price • Prismo Model 160 Paint Striper with Kamber Model 38-1 , 6 gal . A. S .M.E. Paint Tank, and 8 H.P. B & S Engine. 1 2511 . 00 Approximate Freight Charge 145 . 00 PAYMENT TERMS: [*Net 30 days This quotation is valid thru January 10 , 1987 for shipment 30 days after acceptance of order. Prismo Safety Corporation ZZ2,2611 % By. Beverly A. Eck Unless otherwise stated, prices quoted are for the above listed quantities shipped at one time. Prices may change if quantities differ from those shown above. Title: Telemarketing THIS QUOTATION IS NOT AN OFFER AND IS NOT LEGALLY BINDING ON PRISMO. ALL SALES BY PRISMO SHALL BE SUBJECT EXCLUSIVELY TO PRISMO-'S TERMS AND CONDITIONS OF SALE SET FORTH ON THE BACK HEREOF. MODEL 160 '' 0 The Prismo Model 160 is a quick-loading, .-�" mow ' • easy to operate, all purpose paint striper for commercial , industrial and municipal shortline work. The even weight distribution and big "'"`' 41 pneumatic tires make the Model 160 �.. easy to maneuver, even on athletic :j fields. ' The paint gun is strategically mounted so the front tire protects it from head- PU; on obstacles. The gun can also be re- positioned in front of the mount to permit striping right up to the curb. BASIC SPECIFICATIONS DIMENSIONS: Length - 57"; Width - WHEELS: Front - Single 11X4.00-5 pneumatic 37" ; Height - 41"; Weight - 240 lbs. tire with 5/8" ball bearings. CHASSIS: Rigid steel welded tubular Rear - Two 4.80/4.00-8 pneumatic frame. tires with 3/4" ball bearin g POWER: 5.0 bhp at 3600 rpm - air CONTROLS: Micro-valve. cooled. POINTER: 30" sliding telescopic. LINE WIDTH: 2" to 6". CLEANER SYSTEM: 1 quart capacity, gravity NUMBER OF LINES: One. flow. AIR SUPPLY: Twin cylinder, piston- PRESSURE GAUGES: Atomizing, Manifold & Paint. type compressor; 10.24 cfm dis- OPTIONS: placement. PAINT SUPPLY: 7-gallon tank with 6" - Hand Gun Take-Off Assembly opening; hinged lid. - Parking Brake - Traction SPRAY GUN: Prismo Nu-Matic with uniform - Six Gallon A.S.M.E. Paint Tank with 14" cross distribution. Opening - Pressure Solvent System LINE DELINEATOR: Prismo shroud. - Spheroliner Glass Bead Dispenser and Hopper First in Transportation Safety. Prismo Safety Corporation 300 Lanidex Plaza,Parsippany,NJ 07054 Phone:(201)884-0300 Telex: 136-361 [ ® Ir CARRIER & CABLE, INC. 24110 Research Drive Farmington Hills Michigan 48024 MARKETING SALES SERVICE Telephone (313) 477-8700 • Village of St. Anthony T 3301 Silver Lake Road ° Minniapolis , MN 55418 Attn: Larry Hamer DATE SHIPMENT WITHIN TERMS SHIPPING TERMS 12-11-87 I 45 Days NET 30 DAYS FREGHT PPD.BALLLDT OTHER - ITEM QUANTITY PART NUMBER AND DESCRIPTION UNIT PRICE EXTENSION 1 Model 160 Paint striper with a Kamber 38-1 3178 . 48 3178 . 48 Paint gun, 6 gal. A.S .M.E. paint tank , and 8 hp. Briggs & Straton engine • Freight 160 .00 160 . 00 cc : Village of St. Anthony Mr. Jim Lorbeski 3801 Chandler Minneapolis , MN 55421 (Z/n-,--o. -- • BY TOTAL AMOUNT $3338 . 48 Timothy DeWitt/rp a aid hon 1 � rf--\ APPROVAL December 30, 1987 vA TO Mayor and Councilmembers ,F '4ZOM : Larry Hamer, Public Works Director T-T EM : 3/4 TON 4 X 4 PICK UP TRUCK Hennepin- County Purchas-ing received and awarded bids- on light trucks: -The City of St. Anthony has budgeted $12,000 for one 3/4 ton pick up truck. The bid for Item F, Contract 8541, was awarded by Hennepin County to Valley Sales G.M.C. for $11,859 plus 6% excise tax. (The cities are now required to pay a 6% excise tax. ) I recommend the City purchase per above. r :cjk1.12.88 CONTRACT NO. 8541 PROPOSAL OF A J/C2, E. 3/4 Ton Pickup, V8 9 3 5 00, Options: Add H or Deduct (-) 1. Window, sliding rear 3 ( + S 3 o S Total Amount, Item ''c ° . . . . ° ° ° . . . ° . . • • • State cost and any quantity• limitations for special color: Parts Manual S �- Service Manual $ �� State the number of calendar days from Purchase Order Cut-Off Date by which time delivery will be completed. (See paragraph 7. ) �S days F. 3/4 Ton 44 Pickup 4 35-Od S �. Z`f 5 `�'�,5� �_• Options: Add (+) or Dedust'(-) 1. Heavy duty snow plow package. See specifi- cations. 2. 711' snow plow, power angle, electric hydraulic power unit, plow lights and frame-- �� S all installed 1 ( + ) S_JV Total Amount, Item F . . . . . . . . . . . . . . . . . . . . . S State cost and any quantity limitations for special color: Parts Manual 5 q S Service Manual g State the number of calendar days from Purchase Order Cut-Off Date by which time delivery will be completed. (See paragraph 7. ) S days Page 3 of 11 Pages CITY OF CITY OF COLUMBIA HEIGHTS �=�7 at (61 L),7872L1 x = "SERVICE IS OUR BUSINESS" December 18, 1987 Mr. Larry Hamer Public Works Director City of St. Anthony 3301 Silver Lake Road St. Anthony, MN 55418 RE: SUPPLEMENTAL ENGINEERING SERVICES Dear Larry: The 1988 service charges are listed below. The extent and terms for these services are outlined in an agreement approved by the City Councils of St. Anthony and • Columbia Heights on March 10, 1987, and May 11 , 1987, respectively. BUYER agrees to pay the VENDOR the following charges for services provided upon presentation by the VENDOR of an itemized statement of the amount of time incurred for services to BUYER and how said time was spent. a. Labor charges for 1988 shall be $63.99 per hour for principal engineer, $46.1.3 per hour for assistant engineer, $40.11 per hour for Tech IV, $34.98 per hour for Tech III, and $29.45 per hour for Tech II. b. Printing charges using the Diazo Blueline Printer without labor: $0.26 per sheet 22 X 34 Standard Blueline Prints $0.28 per sheet 24 X 36 Standard Blueline Prints $0.044 per sheet Standard Blueline Prints $3.53 per sheet 22 X 34 Diazo Milar $1 .15 per sheet 24 X 36 Sepia Paper Printing charges using the Diazo Blueline Printer with labor: $0.88 per sheet 22 X 34 Standard Blueline Prints $1 .00 per sheet 24 X 36 Standard Blueline Prints $0.164 per sheet Standard Blueline Prints $4.15 per sheet 22 X 34 Diazo Milar $1 .87 per sheet 24 X 36 Sepia Paper • Bruce G. Nawrocki, Mayor Rita M. Petkoff, Councilmember`. Russell D. Paulson, Councilmember Edward M. Carlson, Councilmember Gary L. Peterson, Councilmember EQUAL OPPORTUNITY EMPLOYER • SUPPLEMENTAL ENGINEERING SERVICES DECEMBER 18, 1987 PAGE TWO c. Drafting paper: $1 .15 per sheet Cross-section Tracing Paper $1 .15 per sheet Plan or Profile Tracing Paper If you have any questions, please call. Sincerely, aot R h 'ean K. Young at y� g, Assistant City Engineer KKY/km 87-571 • STUART J . BONNIWELL Certified Public Accountant • 7101 York Avenue South Telephone Minneapolis, Minnesota 55435 (612) 921-3354 December 21, 1987 Mr. David M. Childs City Manager City of St. Anthony 3301 Silver Lake Road St. Anthony, MN 55418 Dear Mr. Childs: I wish to confirm my understanding of the arrangements for the services to be performed for the City of St. Anthony for the year ending December 31, 1987. If these arrangements are in accordance with your understanding, please sign this letter and return it to me in the enclosed envelope. I will examine the financial statements of the City of St. Anthony for the year ending December 31, 1987, and express an opinion on the fairness of presentation of the statements in conformity with generally accepted accounting principles. My ability to express an opinion and the wording of my opinion will depend on the facts and circumstances at the date of the report. If my opinion will be other than unqualified, I will discuss the reasons with you before submitting a different kind of report. The financial statements are the representation of management, who has the responsibility for properly recording transactions, for safeguarding assets and for establishing a system of internal control that will, among. other things, help assure the accuracy of the financial statements. My examination will be performed in accordance with generally accepted auditing standards, which will include a review of the system of internal control, analytical reviews and tests of the transactions to the extent I consider necessary. It will include selective testing of sample trans actions, but it will not include a detailed audit of transactions to the extent necessary to disclose defalcations or other irregularities should any exist. Mr. David M. Childs City of St. Anthony December 21_, 1987 Page 2 I will report to you any material internal control weaknesses noted during the examination. I also will submit any significant ideas or observations I believe will help achieve objectives of the City or improve efficiency in operations. I will be pleased to respond to inquires you might have about financial or other business matters. I wish to assure you that the report on the examination of the City's financial statements will be submitted on a timely basis, sufficiently 'in advance of required deadlines so that an opportunity for review, analysis and discussion will exist. Assistance to be supplied by your personnel, including the preparation of-schedules and analyses of accounts, will be discussed and coordinated with you. Completion of this work will help complete the examination on a timely basis. Fees are based on the time required to complete the engagement, plus out-of-pocket expenses. Assuming adaquate cooperation and assistance from your personnel during the conduct of the examination, I estimate that fees for the audit shall not exceed $11,200. If time and fees required to complete the audit are less than this amount, the Council will be billed the lesser amount. I am pleased to have this opportunity to serve you again. Sincerely, Stuart J. Bonniwell Accepted: City of St. Anthony By: RESOLUTION 88-001 ' A RESOLUTION DESIGNATING MAYOR PRO TEM FOR CALENDAR YEAR 1988 BE IT RESOLVED by the City Council of the City of St. Anthony that is designated as Mayor Pro Tem for the year 1988. Adopted this day of 1988. Mayor ATTEST: City Clerk Reviewed for administration: City Manager • RESOLUTION 88-002 A RESOLUTION APPROVING THE SIGNATURE OF THE MAYOR, FINANCE DIRECTOR, AND THE CITY MANAGER ON ALL DRAFTS DRAWN AGAINST DEPOSITS OF THE CITY OF ST. ANTHONY, MINNESOTA BE IT RESOLVED by the City Council of the City of St. Anthony that the signature of the Mayor, Finance Director and City Manager shall appear on all checks or drafts drawn upon deposits of the City of St. Anthony for the fiscal year 1988. Adopted this day of 1988. Mayor ATTEST: City Clerk Reviewed for administration: City Manager • • RESOLUTION 88-003 A RESOLUTION DESIGNATING LEGAL NEWSPAPER FOR THE CALENDAR YEAR 1988 BE IT RESOLVED by the City Council of the City of St. Anthony, Minnesota, that a legal newspaper of general circulation in the City, be hereby designated as the official newspaper of the City for 1988 in which shall be published such measures and matters as are by-laws of this State and City Code required to be published; and such other matters as the Council may deem advisable and in the public interest to have published. • Adopted this day of 1988. Mayor ATTEST: City Clerk Reviewed for administration: City Manager • NEW BRIGHTON 909 Seventh Ave. N.W. SHOREVIEW New Brighton, Minnesota 55112'BULLITIN ST. ANTHONY Phone 633-2777 Published by Lillie Suburban Newspapers, Inc. serving the cities of Arden Hills, Mounds View, New Brighton, St. Anthony and Shoreview N. THEODORE LILLIE, Publisher GENE SKIBA, Editor December 15 , 1987 St. Anthony City Council St. Anthony City Offices 3301 Silver Lake Road St. Anthony , MN 55418 Dear Mayor and Council : The Bulletin would be honored and privileged to serve as your city ' s legal newspaper during 1988, and we ask • reappointment to that function . We submit the following quotation on the publishing of legal notices and publications during 1988. Legal publication rates for minutes of regular and special meetings , notices , bids , etc. are : $5 . 18 per column inch , $6. 92 per column inch for tabulated matter, and $3. 45 per column inch for each additional publication . Thank you for your kind consideration. We look forward to assisting you .in another year of successful operation . Very truly yours , Gene F . Skiba, Editor • BULLETIN NEWSPAPERS GFS/yw RESOLUTION 88-004 A RESOLUTION ESTABLISHING MARCH 15 , 1988 AS CUT-OFF DATE FOR RECEIVING PETITIONS FOR PUBLIC IMPROVEMENTS WHEREAS, the City Council of the City of St. Anthony has considered its construction program; and WHEREAS, the City Council deems it necessary to establish a time limit on the requests for public improvements so as to insure adequate time to comply with the improvement procedures as established in the Minnesota State Statutes. NOW, THEREFORE, BE IT RESOLVED, that the City Council of the City of St. Anthony hereby establishes March 15th as the final day for accepting petitions for public improvements to be included in the 1988 construction program. Adopted this day of 1988 . Mayor ATTEST: City Clerk Reviewed for administration: City Manager • • RESOLUTION 88-005 A RESOLUTION DESIGNATING THE OFFICIAL DEPOSITORY FOR CITY FUNDS BE IT RESOLVED by the City Council of the City of St. Anthony, that the St. Anthony National Bank is hereby designated as a depository for the funds of the City and that said bank shall also be the bank for this City with respect - to any/all other banking services required or used by this City provided, however, that in the event the City has occasion to purchase U.S. Treasury Bills, U.s. Treasury Notes , C.D. ' s, or other similar investments, the City shall solicit from the St. Anthony National Bank, and from any other approved institutions, the rate of interest each institution is willing to pay; and the City shall purchase said U.s. Treasury Bills , U.S. Treasury Notes, C.D. ' s, or similar investments from the institution offering the highest rate to the City. If any institution offers the same rate of interest as the interest rate offered by the St. Anthony National Bank, the purchase shall be made from the St. Anthony National Bank, provided that this is the highest rate offered. FURTHER RESOLVED that the City Clerk shall prepare a quarterly report for the City Manager and the City Council which report shall be in writing and included in the agenda for the following Council meeting; and which report shall contain a summary for the preceding period of all U.S. Treasury Bills, U.S. Treasury Notes, C.D. ' s, and similar investments purchased by the City during such period. Said report shall contain a separate listing of all such purchases made out of the general fund, all such purchases made out of the liquor fund, and all such purchases made out of any other City fund. The report shall contain for each such purchase a schedule of the interest rates offered by the institutions solicited and the interest rate on current investments. FURTHER RESOLVED that this notice shall continue in force until December 31 , 1987 , or until written notice of its recision or modification has been received by said bank. FURTHER RESOLVED that said bank deposit such securities in the amount and in the manner required by law. FURTHER RESOLVED that the City Manager be authorized to accept such securities as collateral as required by law, and that said collateral be deposited at the St. Anthony National Bank for safekeeping. i • I I i -2- FURTHER RESOLVED the City Clerk shall transmit to the St. Anthony National Bank a copy of this resolution. Adopted this day of _ 1988 . Mayor ATTEST: City Clerk Reviewed for administration: City Manager i 5800 85th AVENUE NORTH / BROOKLYN PARK,MN. 55443 /612-424-8000 CITY OF -- BROOKLYN December 28 , 1987 PARK Mayor Robert Sundland 3101 Roosevelt Street NE St . Anthony, MN 55418 Dear Mayor Sundland: As you know, the Northern Mayors' Association has been in existence for more than two years and it has had some success in voicing our concerns to state legislators . It is obvious , however , that not enough resources are available to achieve our .transportation ' goals and to promote economic growth in the northern - suburbs. A Steering Committee was formed to investigate what resources are needed to achieve our objectives. Attached is a copy of the Committee's report which was wholeheartedly accepted and approved • by the Board of Directors on December 21, 1987. The report indicates an annual budget of $100, 000 from member cities to be supplemented by funds generated from the private sector . Fifteen of our 21-member cities were present at the meeting and unanimously agreed to the need of strong support for this program. Concern for a timely, commencement of this project was expressed in order to have an impact with the 1988 state leg.islature starting this January. We strongly encourage your city to adopt the enclosed resolution as soon as possible and return the resolution to the Northern Mayors' Association (c/o Charles, Darth, City of Brooklyn Park , 5800 85th'-Avenue North, Brooklyn Park, MN 55443) by February 15, 1988. If you have any questions , please do not hesitate to contact- me (560-'8022) , Doug Reeder (420-4000) , or' Hank Sinda (633-1533) . Sincerely, mes J . Krautkremer yor.. cc: David Childs , City. Manager • Enclosures JK/zao • RESOLUTION 88-006 A RESOLUTION IN SUPPORT OF INCREASING FUNDING FOR THE NORTHERN MAYORS ' ASSOCIATION WHEREAS , the City of St. Anthony is a member of the Northern Mayors ' Association; and WHEREAS, the Northern Mayors ' Association was formed in 1985 with a stated mission as follows: The mission of the Northern Mayors ' Association is to initiate actions , provide leadership and commit the resources necessary to insure the equitable distribu- tion of economic development, shared tax resources and uniform investment in public facilities throughout the Metropolitan community. We value the equal opportunity for all residents to enjoy the same quality of life. WHEREAS , the Northern Mayors ' Association has to date been effective in increasing communications, coordination and mutual support in matters which affect the Northern Metropolitan area; and • WHEREAS, a Steering Committee was established to determine how the Northern Mayors ' Association could more effectively lobby at the various levels of governmental decision making to achieve the area goals in transportation and economic development and to coordinate and avoid duplicating the efforts of numerous or- ganizations in the area of transportation; and WHEREAS, the Steering Committee has presented a budget for the Northern Mayors ' Association of $100 ,000 to hire full time staff and operate an office or, to retain competent consultants to represent the Association; and WHEREAS, the Northern Mayors ' Association recognizes that additional funds will be needed for promotional purposes, the report adopted by the Association proposes to raise additional funds from the private sector either in cash or in kind contribu- tions on an as needed basis. WHEREAS, the Northern Mayors ' Association member Mayors agreed with the recommendation of the Steering Committee and agreed to take the proposal back to their respective City Councils for approval. NOW, THEREFORE, BE IT RESOLVED that 'the City Council of the City of St. _Anthony agrees with the recommendation of the Northern Mayors ' Association to provide funding for a full time staff (or consultant) to further the lobbying efforts in the area of transportation and economic development of the northern suburbs. BE IT FURTHER RESOLVED that the City Council of the City of St. Anthony agrees to participate in the cost of increasing the lobbying effort by agreeing to pay increased dues for 1988 when billed by the Northern Mayors ' Association, it being understood that the projected dues for the City of St. Anthony for 1988 are $1 , 933 . 00. Adopted this day of 1988 . Mayor ATTEST: City Clerk Reviewed for administration: City Manager NORTHERN MAYORS' ASSOCIATION STEERING COMMITTEE REPORT On November 3 , 198,'7_,_ Bob Thistle, Chairman of the opera- ting Committee appointed a committee to form a strategy for coordinating the promotion of transportation: improvements and economic development in the north metro area. Committee members are: Hank Sinda., City of New Brighton, Chair Rich Johnson, City of Blaine Gerald Splinter, City of Brooklyn Center Jock Robertson, City of Fridley Mark Sievert, City of Dayton Bob Thistle, Coon Rapids Bill Barnhart, Minneapolis Al Hofstedt, Coon Rapids Statement of Problem The East Metropolitan cities have organized and raised $250 , 000 for marketing and promotion in the east metro area. A southwest group of cities have also organized and have raised funds to lobby for transportation improvements in the southwest metro area. Findings of the Steering Committee 1.. The goals of the Northern Mayors ' Association are to promote transportation improvements and economic development in the north metro area. 2. There needs to be a coordinated effort between the Northern Mayors ' Association cities and the follow- ing community organizations: A. North Metro Crossing Coalition B. Anoka County Chamber of Commerce (task force) C. North Metro Convention and Tourism Bureau D. Brooklyn Center Chamber of Commerce E.. New Brighton Chamber of Commerce F. Fridley Chamber of Commerce G. North Metro Traffic Task Force H. Anoka County Economic Development Partnership I . Greater Minneapolis Chamber of Commerce J. North Hennepin Chamber of Commerce K: Robbinsdale Chamber of Commerce L. And each member city in the Northern Mayors ' Association NORTHERN MAYORS' ASSOCIATION STEERING COMMITTEE REPORT Page Two • 3 . Primary transportation projects are : A. Light rail- transit B. Highway 10 by-pass ( from Highway 610 to I-35W) C. 610 Crosstown (Highway 10 to I-94 ) D. Highway 100 (upgrade to freeway status ) E. Widen I-694 F. Another river crossing between Anoka County and Hennepin County G. Monitor metro airport facilities 4 . Primary economic development projects are : A. Northern athletic facility B. Attract anchor industries C. Stimulate support service business D. Encourage a metro resort in the northern area E. Develop a multi-city economic package 5 . The Northern Mayors ' Association should raise $100 , 000 through member cities -- the private sec- for providing additional funding and in-kind assis- tance. 6 . A staff person and clerical support staff should be hired to coordinate efforts to achieve the organi- zation' s goals . 7 . The staff , along with appointed committees , will work to achieve the goals of the organization: A. Identify funding sources for transportation projects such as assessments, transportation utilities, grants, . tolls, gas tax, TIF, pri- vate donations , other contributions , B. Develop a strategic plan to achieve those goals , and C. Implement the plan. • NORTHERN MAYORS' ASSOCIATION . 12-15-87 JOINT POWERS AGREEMENT PROPOSED ANNUAL DUES BY COMMUNITY BASED ON $100,000 BUDGET • (50% PER CAPITA, 50% VALUATION, EXCEPT MINNEAPOLIS WHICH HAS A FIXED RATE) DUES BASED ON ESTIMATED DUES ESTIMATED ASSESSED BASED ON ASSESSED TOTAL CITY POPULATION VALUE POPULATION + VALUE = DUES ---------------------------------------------------------------------- Andover 12095 $ 59731224 $ 1249 $ 969 $ 2218 Anoka 16275 95587713 1681 1550 3231 Blaine 35566 185620480 3673 3010 6682 Brooklyn Center 29759 244194282 3073 3960 7033 Brooklyn Park 52392 334549184 5410 5425 10835 Champlin 13261 61706617 1369 1001 2370 Circle Pines 4705 21316660 486 346 832 Columbia Heights 19430 118093075 2006 1915 3921 Coon Rapids 44599 2531781010 4605 4115 8720 Crystal 25009 135666772 2583 2200 4782 Dayton 4247 19086941 439 309 748 • Fridley 29310 258349173 3027 4189 7216 Maple Grove 33449 213235200 3454 3458 6912 New Brighton 23324 1598831707 2409 2447 4855 New Hope 22785 178619476 2353 2896 5249 Ramsey 11706 53969552 1209 875 2084 Robbinsdale 14528 86744511 1500 1407 2907 St. Anthony 8305 66298492 858 1075 1933 Shoreview 23473 169883738 2424 2.755 5179 Spring Lake Park 6720 37062856 §94 601 1295 ---------- ---------- -------- SUBTOTAL 430938 $2744380663 $ 44500 + $ 44500 = $ 89000 Minneapolis (fixed) 11000 TOTAL $ 100000 MULTIPLIERS 44500 ----------- VALUATION 0.0000162 POPULATION 0.1032631 • . NOTE: Contributions may increase by 10 to 20 percent if not all communities participate. Get airport land nova �== itizens-League .s • says By :aurie Blake bolster the campaign of south Minne- a PConrad deFiebre apolis residents who see a new air- SMITWriteis port as the only hope of relief from jet noise. 4e'.*time to acquire land for a-major peiy-airport is now, in case Minne- But the draft does not call for a new al$ks-St. Paul International Airport airport, which by various estimates cannot keep pace with future de- would cost between$2 billion and$5 maiid, the Citizens League says in a billion. pfrelr'rninary draft of a new report. Instead, the draft calls for steps to B(it the draft also endorses use of the ensure that land is set aside in case a existing airport for as long as possi- new airport is needed. While a site is bk: along with aggressive steps to being acquired, it recommends that r(;3uce air traffic noise and conges- the Metropolitan Council continue tiob to make it a more tolerable studying the issue. ntipbor. -"We do not want to build on the new -fie report is"expected to be adopted site unless it is absolutely necessary," lid::the league board Thursday. It the draft says. would be the first call by a significant public-policy group to begin planning fora new airport. As such, it would Airport continued on page 9B Sta' r Tribune/ Saturday/December 12/1987 .96t AIRPORT: Northwest backs ma or 1 poil . Continued from page I airport will be needed,but when. airport's capacity. move to a new airport as rapidly a possible." Thus,the draft's major recommenda- But the airline industry is changing MAC Chairman Harold Greenwood tions won support even from an out- so rapidly and it takes so long to said the commission is considering at The draft urges some changes at Min spoken corporate opponent of a new build an airport, he said, that the site owned by the University of Min- neapolis-St. Paul to make it mor airport,Northwest Airlines. council is striving for a formula to nesota in Rosemount that has been compatible with the surroundin. determine when a decision to build proposed for a new airport. But, he neighborhoods. All were originall "Being prepared is certainly not a can be made. Much of the time need- stressed,"we're just looking at it." proposed by the Metropolitan Air problem," Northwest spokesman ed to establish an airport goes to site - craft Sound Abatement Council,sail Redmond Tyler said Friday. selection,he said. Nigel Finney,MAC deputy executive the council chairman, Walter Rock director of operations, said the Met- enstein. Forecasts indicate that the existing Because establishing a new airport ropolitan Council would have to de- airport may be too small for future would be so expensive, Keefe said, fine a search area before the commis- The proposed measures include: air travel demand, the draft said. the council also is attempting to as- . sion could seriously look for a new Therefore, officials should use tax semble an economic model to weigh airport site. ■Directing planes when possibl money and airport landing fees now the costs and benefits. over nonresidential areas, and mor to buy a new airport site as close as Anti-noise activists were encouraged equitably distributing the noise ove possible to the center of the metro The Metropolitan Airports Commis- by the league draft. all communities around the airport. area,the draft recommends. sion (MAC) also is studying the air- port's future. Until recently the com- Jan Del Calzo, who represents Min- ■Extending a secondary runwa Airport and government officials re- mission had opposed a new airport. neapolis Mayor Don Fraser on the toward Bloomington and Richfrel ceived the draft favorably. But they Its staff still maintains that there is MAC, called the report a prudent as a way to relieve some of the nois would need to reverse metro govern- plenty of life left in Minneapolis-St. recommendation to secure land 20 to over south Minneapolis. ment policies to follow league recom- Paul International. 30 miles from downtown, instead of mendations. waiting and being forced to locate ■Using airport landing fees to ea Robert Stassen, MAC deputy execu- much farther away. pand noise abatement efforts,such a Two years ago the Metropolitan . tive director of administration, said insulating some homes and publi Council found no need for a new yesterday, "We don't really see that Minneapolis City Council Member buildings and buying others. airport when it updated its aviation this airport necessarily will ever over- Steve Cramer, who represents noise- master plan. And it has no plans to run its capacity. But, on the other weary residents of the 1 Ith Ward, ■Enforcing noise reduction goalf b outline an area appropriate for an hand, we recognize the need to keep said the report "gives real legitimacy ordinance if voluntary airline agrer airport, as the league urges. But the monitoring to make sure." to the issues of noise and air traffic ments fail to meet the goals council is studying the issue again, growth." and is expected to deliver a fresh He said landings and takeoffs this In addition, the draft urges shar opinion late next year on whether the year are expected to total around As for the recommendation that the increases in landing fees at Minn( Twin Cities needs a new airport. 300,000, a decline from previous existing airport remain open for as apolis-St. Paul to encourage sma years and far short of the limit of long as possible, Cramer said: planes to use other airports.Fees als Council Chairman Steve Keefe said 500,000 the Federal Aviation Admin- "That's open to interpretation as to should be adjusted to spread traff the question is not whether a new istration uses as the estimate of the how long is possible. We want to to nonpeak hours,it said. DATE: December 28, 1987 TO: City Council Members FROM: Don Hickerson, Chief of Police SUBJECT: Proposed New Ordinances The following two proposed ordinances were sent to the City Attorney for reviewal and-modification as necessary. 1. Weapons Ordinance - This ordinance would' cover possession of assault type weapons such as nunchaku, chaka, karate sticks etc. which are not presently covered by an ordinance and which we are encountering on the streets and in the schools. This proposed ordinance would allow for prosecution in. these instances. 2. Controlled Substance or (Drug) Ordinance - This ordinance is necessary so we can charge as a misdemeanor those cases turned down as felonies by the County Attorneys. (Under 2 ounces of Marijuana and under 3 grams of cocaine etc.) At the present time we are unable to charge anyone who possesses under these amounts because of the County Attorney guidelines. • The proposed Ordinance would allow for prosecution.in these instances. I. recommend that both of these ordinances be adopted by the City Council.. • • CITY OF ST. ANTHONY ORDINANCE 1988- 001 AN ORDINANCE RELATING TO WEAPONS, AMENDING SECTION 925 OF THE 1973 ST. ANTHONY CODE OF ORDINANCES IN ITS ENTIRETY; REPEALING SECTION 930 OF THE 1973 ST. ANTHONY CODE OF ORDINANCES The City Council of the City of St . - Anthony hereby ordains : Section 1. Section 925 of the 1973 St . Anthony Code of Ordinances is amended to read in full as follows : Section 925 - Weapons Subdivision 1 . Definitions . For purposes of this Section, the following terms will have the meanings given them in this Subdivision : 1 . "Weapons" means any of the following : (a) All firearms , including any device from which is propelled any missile, projectile, or bullet by means of explosives, gas , compressed air, springs, or elastic material , including air and "BB" guns . (b) Dagger , dirk, or stiletto. (c ) Saber or sword. (d) Switchblade knife, spring blade knife or any knife the blade of which can be opened by gravity or a flick of the wrist . (e) Blackjack, sand club, sap, pipe club, bludgeon . (f ) Chain club or chains assembled or used or intended to be used as a weapon . (g) Artificial knuckles or other objects designed to be worn over the fist or knuckles . (h) Throwing devices with cutting or pointed edges . (i ) Japanese or other nightsticks , nutcracker, nunchaku, chaka, flail , karate stick, morning star . (j ) Slingshots . (k) Spear, lances . 2 . "Public place" means any area, building or structure which is open and accessible to the public . • Subdivision 2 . Possession Prohibited. No person shall have a weapon in his or her possession, custody, or control • in a public place, in the residence of another without their permission, or in the passenger compartment of a motor vehicle, within the City of St . Anthony. Subdivision 3 . Transportation of Weapon . A weapon may be transported in a motor vehicle only if it is : ( 1) a firearm which is unloaded and in a gun case expressly made to contain a firearm, and the case fully encloses the firearm by being zipped, snapped, buckled, tied, or otherwise fastened, and without any portion of the firearm exposed, and is in the closed trunk of the motor vehicle, (2 ) a weapon other than a firearm which is in a fastened container in the closed trunk of a motor vehicle , or ( 3 ) a handgun carried in compliance with Minnesota Statutes , Sections 624 . 714 and 624 . 715 . Subdivision 4 . Discharge of Firearm. No person in any public or private place shall shoot or discharge any firearm, as defined in this Section, whether it is loaded with powder, blank cartridges or any other explosive , bullet, pellet, or shot , without prior authorization from the Chief of Police . Subdivision 5 . Exceptions . This Section shall not apply • to the discharge of a firearm in the lawful defense of person, property, or family, or in the necessary enforcement of law. This Section shall not apply to law enforcement officers, military personnel while on duty, or to possession of handguns or, pistols permitted under Minnesota Statutes, Sections 624 . 711 through 624 .717 . Subdivision 6 . Confiscation. Any weapon adjudged by any Court of competent jurisdiction to have been worn, carried, possessed, used or handled in violation o.f any ordinance or state statute, may be confiscated and disposed of by the Chief of Police, who may provide for its sale , destruction or other disposition . Subdivision 7 . Use of Bow and Arrow. It is unlawful for any person to shoot a bow and arrow in the City, except in the physical education program of a school supervised by a member of the school ' s faculty, or in a community-wide supervised class or event specifically authorized by the Chief of Police . Section 2 . Section 930 of the 1973 St . Anthony Code of Ordinances is repealed. • - 2 - • Section 3 . This Ordinance shall take effect upon its date of publication . Mayor ATTEST: City Clerk First Reading : January 12 , 1988 Second Reading : Adopted: Published in the St . Anthony Bulletin on the day of • 1987 . • 3 - CITY OF ST. ANTHONY ORDINANCE 1988-002 AN ORDINANCE RELATING TO THE REGULATION OF CONTROLLED SUBSTANCES; AMENDING THE 1973 CODE OF ORDINANCES TO ADD A SECTION The City Council of the City of St . Anthony hereby ordains : Section 1 . The St . Anthony 1973 Code of Ordinances is amended to add a new Section 964 to read as follows : Section 964 - Controlled Substances Section 964 : 00 . Controlled Substance Defined. For purposes of this Ordinance, "controlled substance" means a "controlled substance" as defined in Minnesota Statutes, Chapter 152 . Section 964 : 05 . Possession Defined. For purposes of this Ordinance, "possession" means having a controlled substance on one' s person or in constructive • possession including, but not limited to, constructive possession by an owner of a motor vehicle, or by a driver of a motor vehicle if the owner is not present, who keeps a controlled substance in a motor vehicle or allows it to be kept in the motor vehicle. Section 964 : 10 . Prohibited Acts . No person shall manufacture, possess, constructively possess, sell, give away, barter, exchange, distribute, or otherwise transfer any controlled substance, except by way of a lawful prescription by a person licensed by law to prescribe and administer controlled substances . Section 964 : 15 . Exceptions . Section 964 : 10 does not apply to the following in the ordinary course of their lawful trade, business , or profession, but this Section is not a defense to violations of Section 964 .20 : (a) Practitioners and other persons licensed by law to prescribe and administer controlled substances . (b) Pharmacists duly registered and licensed with the Minnesota State Board of Pharmacy. • (c) Manufacturers authorized by law to • manufacture controlled substances . (d) Wholesalers authorized by law to sell controlled substances . (e) Warehouse operators authorized by law to store controlled substances . (f) Persons engaged in transporting controlled substances as an agent or employee of an authorized practitioner, pharamacist, manufacturer, warehouse operator, wholesaler or common carrier. (g) Public officers or public employees in the performance of official duties requiring possession or control of controlled substances, or persons aiding such officers or employees in the performance of such duties . (h) A patient using controlled substances in accordance with prescribed treatment . (i) Persons who procure, possess or use controlled substances for the purpose of lawful research, teaching or testing, and not for sale. (j ) Lawfully licensed and registered hospitals or bona fide clinics or other institutions for treatment of sick or injured persons or • animals . Section 964 : 20 . Unlawful Procuring Purchase Delivery or Possession. No person shall procure, purchase, .deliver, or possess, or attempt to procure, purchase, deliver, or possess, a controlled substance by: (a) fraud, deceit, misrepresentation or subterfuge, (b) forgery or alteration of a prescription, (c) concealment of a material fact, (d) use of a false name or address, (e) false statement in any prescription, order, report, or record relative to a controlled substance, (f) falsely assuming the title of, or falsely representing any person to be, a manufacturer, wholesaler, warehouse operator, pharmacist, practitioner or other person described in Section 964 : 15, or (g) making, issuing or uttering any false or forged prescription. -2- Section 964 : 25 . Confiscation and Disposition. Any controlled substance found in the possession of anv person convicted of a violation of this Ordinance shall be confiscated and forfeited to the Chief of Police, who shall destroy it . Section 964 : 30 . Use of Original Containers and Labels Required . A patient having possession of a controlled substance by lawful prescription shall keep the controlled substance in the -original container in which it was delivered until used in accordance with the prescription, and shall not remove the pharmacist ' s original label identifying the prescription. Section 964 : 35 . Possession of Injection Implement . No person except dealers in surgical instruments., apothecaries , physicians, dentists,. veterinarians , nurses, attendants and interns of hospitals, sanitoriums or any other institution in which persons are treated for disability or disease, shall at any time have or possess any hypodermic syringe or needle or any instrument adapted for the use of controlled substances, or as defined in Title 21 United States Code 321 (Section 201 of the Federal Food, Drug and Cosmetic Act (V) ) , by subcutaneous injections , and • which is possessed for that purpose, unless such possession be authorized by the certificate of a physician issued within a period of one year- prior to the time of such possession. Section 2 . This Ordinance shall be effective as of its date of publication. First Reading : January 12 , 1988 Second Reading: - Adopted: Mayor ATTEST: City Clerk Published:* St. Anthony bulletin on the day of , 1987. • -3-